acadm | GeneID:406283 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 406283 Official Symbol acadm
Locus N/A Gene Type protein-coding
Synonyms fb53e01; wu:fb53e01; zgc:111905; zgc:56101; zgc:76911
Full Name acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain
Description acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain
Chromosome N/A
Also Known As MCAD; medium-chain acyl-CoA dehydrogenase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3

ID Symbol Protein Species
GeneID:34 ACADM NP_000007.1 Homo sapiens
GeneID:11364 Acadm NP_031408.1 Mus musculus
GeneID:24158 Acadm NP_058682.1 Rattus norvegicus
GeneID:38864 CG12262 NP_648149.1 Drosophila melanogaster
GeneID:173979 K05F1.3 NP_495142.1 Caenorhabditis elegans
GeneID:181757 T08G2.3 NP_510788.1 Caenorhabditis elegans
GeneID:181758 T25G12.5 NP_510789.1 Caenorhabditis elegans
GeneID:406283 acadm NP_998175.1 Danio rerio
GeneID:469356 ACADM XP_524741.2 Pan troglodytes
GeneID:490207 ACADM XP_547328.2 Canis lupus familiaris
GeneID:505968 ACADM NP_001068703.1 Bos taurus
GeneID:1276346 AgaP_AGAP005662 XP_315683.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0008152 Process metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_213010 NP_998175
2 NM_213089 NP_998254

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000099233 MI0001965 dre-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSDART00000099233 MI0001966 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000099233 MI0001967 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000099233 MI0001968 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000099233 MI0001969 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000099233 MI0001970 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000099233 MI0001971 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000099233 MI0001972 dre-miR-125a UCCCUGAGACCCUUAACCUGUG
ENSDART00000099233 MI0001973 dre-miR-125a UCCCUGAGACCCUUAACCUGUG
ENSDART00000099233 MI0001975 dre-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSDART00000099233 MI0001976 dre-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSDART00000099233 MI0001977 dre-miR-125b UCCCUGAGACCCUAACUUGUGA
ENSDART00000099233 MI0001978 dre-miR-125c UCCCUGAGACCCUAACUCGUGA
ENSDART00000099233 MI0001993 dre-miR-133a* AGCUGGUAAAAUGGAACCAAAU
ENSDART00000099233 MI0002036 dre-miR-196b UAGGUAGUUUCAAGUUGUUGGG
ENSDART00000099233 MI0002048 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000099233 MI0002049 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000099233 MI0001384 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000099233 MI0001385 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000099233 MI0002054 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000099233 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000099233 MI0003690 dre-miR-34b UAGGCAGUGUUGUUAGCUGAUUG
ENSDART00000099233 MI0001360 dre-miR-7b UGGAAGACUUGUGAUUUUGUU
ENSDART00000099233 MI0004880 xtr-miR-367 AAUUGCACUGUAGCAAUGGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Harden MV, et al. (2006) "Olfactory imprinting is correlated with changes in gene expression in the olfactory epithelia of the zebrafish." J Neurobiol. 66(13):1452-1466. PMID:17013923
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932