acadm | GeneID:406283 | Danio rerio
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 406283 | Official Symbol | acadm |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | fb53e01; wu:fb53e01; zgc:111905; zgc:56101; zgc:76911 | ||
| Full Name | acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain | ||
| Description | acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain | ||
| Chromosome | N/A | ||
| Also Known As | MCAD; medium-chain acyl-CoA dehydrogenase | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 3
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:34 | ACADM | NP_000007.1 | Homo sapiens |
| GeneID:11364 | Acadm | NP_031408.1 | Mus musculus |
| GeneID:24158 | Acadm | NP_058682.1 | Rattus norvegicus |
| GeneID:38864 | CG12262 | NP_648149.1 | Drosophila melanogaster |
| GeneID:173979 | K05F1.3 | NP_495142.1 | Caenorhabditis elegans |
| GeneID:181757 | T08G2.3 | NP_510788.1 | Caenorhabditis elegans |
| GeneID:181758 | T25G12.5 | NP_510789.1 | Caenorhabditis elegans |
| GeneID:406283 | acadm | NP_998175.1 | Danio rerio |
| GeneID:469356 | ACADM | XP_524741.2 | Pan troglodytes |
| GeneID:490207 | ACADM | XP_547328.2 | Canis lupus familiaris |
| GeneID:505968 | ACADM | NP_001068703.1 | Bos taurus |
| GeneID:1276346 | AgaP_AGAP005662 | XP_315683.2 | Anopheles gambiae |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0003995 | Function | acyl-CoA dehydrogenase activity |
| GO:0009055 | Function | electron carrier activity |
| GO:0050660 | Function | FAD binding |
| GO:0016491 | Function | oxidoreductase activity |
| GO:0016627 | Function | oxidoreductase activity, acting on the CH-CH group of donors |
| GO:0008152 | Process | metabolic process |
| GO:0055114 | Process | oxidation reduction |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSDART00000099233 | MI0001965 | dre-miR-122 | UGGAGUGUGACAAUGGUGUUUG |
| ENSDART00000099233 | MI0001966 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000099233 | MI0001967 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000099233 | MI0001968 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000099233 | MI0001969 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000099233 | MI0001970 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000099233 | MI0001971 | dre-miR-124 | UAAGGCACGCGGUGAAUGCCAA |
| ENSDART00000099233 | MI0001972 | dre-miR-125a | UCCCUGAGACCCUUAACCUGUG |
| ENSDART00000099233 | MI0001973 | dre-miR-125a | UCCCUGAGACCCUUAACCUGUG |
| ENSDART00000099233 | MI0001975 | dre-miR-125b | UCCCUGAGACCCUAACUUGUGA |
| ENSDART00000099233 | MI0001976 | dre-miR-125b | UCCCUGAGACCCUAACUUGUGA |
| ENSDART00000099233 | MI0001977 | dre-miR-125b | UCCCUGAGACCCUAACUUGUGA |
| ENSDART00000099233 | MI0001978 | dre-miR-125c | UCCCUGAGACCCUAACUCGUGA |
| ENSDART00000099233 | MI0001993 | dre-miR-133a* | AGCUGGUAAAAUGGAACCAAAU |
| ENSDART00000099233 | MI0002036 | dre-miR-196b | UAGGUAGUUUCAAGUUGUUGGG |
| ENSDART00000099233 | MI0002048 | dre-miR-216b | UAAUCUCUGCAGGCAACUGUGA |
| ENSDART00000099233 | MI0002049 | dre-miR-216b | UAAUCUCUGCAGGCAACUGUGA |
| ENSDART00000099233 | MI0001384 | dre-miR-219 | UGAUUGUCCAAACGCAAUUCUU |
| ENSDART00000099233 | MI0001385 | dre-miR-219 | UGAUUGUCCAAACGCAAUUCUU |
| ENSDART00000099233 | MI0002054 | dre-miR-219 | UGAUUGUCCAAACGCAAUUCUU |
| ENSDART00000099233 | MI0001922 | dre-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENSDART00000099233 | MI0003690 | dre-miR-34b | UAGGCAGUGUUGUUAGCUGAUUG |
| ENSDART00000099233 | MI0001360 | dre-miR-7b | UGGAAGACUUGUGAUUUUGUU |
| ENSDART00000099233 | MI0004880 | xtr-miR-367 | AAUUGCACUGUAGCAAUGGUGA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Harden MV, et al. (2006) "Olfactory imprinting is correlated with changes in gene expression in the olfactory epithelia of the zebrafish." J Neurobiol. 66(13):1452-1466. PMID:17013923 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
Odors experienced as juveniles can have significant effects on the behavior of mature organisms. A dramatic example of this occurs in salmon, where the odors experienced by developing fish determine the river to which they return as adults. Further examples of olfactory memories are found in many animals including vertebrates and invertebrates. Yet, the cellular and molecular bases underlying the formation of olfactory memory are poorly understood. We have devised a series of experiments to determine whether zebrafish can form olfactory memories much like those observed in salmonids. Here we show for the first time that zebrafish form and retain olfactory memories of an artificial odorant, phenylethyl alcohol (PEA), experienced as juveniles. Furthermore, we demonstrate that exposure to PEA results in changes in gene expression within the olfactory sensory system. These changes are evident by in situ hybridization in the olfactory epithelium of the developing zebrafish. Strikingly, our analysis by in situ hybridization demonstrates that the transcription factor, otx2, is up regulated in the olfactory sensory epithelia in response to PEA. This increase is evident at 2-3 days postfertilization and is maintained in the adult animals. We propose that the changes in otx2 gene expression are manifest as an increase in the number of neuronal precursors in the cells olfactory epithelium of the odor-exposed fish. Thus, our results reveal a role for the environment in controlling gene expression in the developing peripheral nervous system.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).