acbd3 | GeneID:406270 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 406270 Official Symbol acbd3
Locus DKEY-267P15.1 Gene Type protein-coding
Synonyms si:dkey-267p15.1; zgc:66303
Full Name acyl-Coenzyme A binding domain containing 3
Description acyl-Coenzyme A binding domain containing 3
Chromosome N/A
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0000062 Function acyl-CoA binding
GO:0005488 Function binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_212997 NP_998162

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000067798 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000067798 MI0002009 dre-miR-144 UACAGUAUAGAUGAUGUACU
ENSDART00000067798 MI0002017 dre-miR-152 UCAGUGCAUGACAGAACUUUGG
ENSDART00000067798 MI0001384 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000067798 MI0001385 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000067798 MI0002054 dre-miR-219 UGAUUGUCCAAACGCAAUUCUU
ENSDART00000067798 MI0001918 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000067798 MI0001919 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000067798 MI0001920 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000067798 MI0001921 dre-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSDART00000067798 MI0002062 dre-miR-301c CAGUGCAAUAGUAUUGUCAUAG
ENSDART00000067798 MI0004781 dre-miR-735 CUCUCCCACCGCUAAACUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932