ABCB1 | GeneID:403879 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 403879 Official Symbol ABCB1
Locus N/A Gene Type protein-coding
Synonyms MDR1; p-gp
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 1
Chromosome N/A
Also Known As ATP-binding cassette, subfamily B, member 1; P-glycoprotein; multidrug resistance p-glycoprotein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55496

ID Symbol Protein Species
GeneID:5243 ABCB1 NP_000918.2 Homo sapiens
GeneID:18671 Abcb1a NP_035206.1 Mus musculus
GeneID:36582 Mdr50 NP_523740.3 Drosophila melanogaster
GeneID:170913 Abcb1 NP_596892.1 Rattus norvegicus
GeneID:178215 pgp-1 NP_502413.1 Caenorhabditis elegans
GeneID:180165 pgp-9 NP_507487.1 Caenorhabditis elegans
GeneID:281585 ABCB1 XP_590317.3 Bos taurus
GeneID:395712 ABCB1 NP_990225.1 Gallus gallus
GeneID:403879 ABCB1 NP_001003215.1 Canis lupus familiaris
GeneID:420534 ABCB4 XP_418636.2 Gallus gallus
GeneID:463516 ABCB1 XP_001163342.1 Pan troglodytes
GeneID:822463 AT3G28345 NP_189475.1 Arabidopsis thaliana
GeneID:822465 PGP16 NP_189477.1 Arabidopsis thaliana
GeneID:822467 PGP17 NP_189479.1 Arabidopsis thaliana
GeneID:822468 PGP18 NP_189480.1 Arabidopsis thaliana
GeneID:822471 AT3G28415 NP_683599.1 Arabidopsis thaliana
GeneID:2538709 pmd1 NP_588265.1 Schizosaccharomyces pombe
GeneID:2675205 MGG_00141 XP_369103.2 Magnaporthe grisea
GeneID:4328568 Os02g0190000 NP_001046147.1 Oryza sativa
GeneID:4328570 Os02g0190300 NP_001046148.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001003215 NP_001003215

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000002896 MI0004757 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU
ENSCAFT00000002896 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSCAFT00000002896 MI0005032 bta-miR-181c AACAUUCAACCUGUCGGUGAGUUU
ENSCAFT00000002896 MI0004742 bta-miR-21 UAGCUUAUCAGACUGAUGUUGACU
ENSCAFT00000002896 MI0005021 bta-miR-380-3p UAUGUAAUGUGGUCCACGUCU
ENSCAFT00000002896 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000002896 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000002896 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000002896 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSCAFT00000002896 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSCAFT00000002896 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSCAFT00000002896 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSCAFT00000002896 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSCAFT00000002896 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSCAFT00000002896 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSCAFT00000002896 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSCAFT00000002896 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000002896 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000002896 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSCAFT00000002896 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSCAFT00000002896 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSCAFT00000002896 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSCAFT00000002896 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSCAFT00000002896 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000002896 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000002896 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSCAFT00000002896 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENSCAFT00000002896 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENSCAFT00000002896 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSCAFT00000002896 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSCAFT00000002896 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSCAFT00000002896 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSCAFT00000002896 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSCAFT00000002896 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSCAFT00000002896 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSCAFT00000002896 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSCAFT00000002896 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSCAFT00000002896 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA
ENSCAFT00000036852 MI0004757 bta-miR-181a AACAUUCAACGCUGUCGGUGAGUU
ENSCAFT00000036852 MI0005013 bta-miR-181b AACAUUCAUUGCUGUCGGUGGGUUU
ENSCAFT00000036852 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000036852 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSCAFT00000036852 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000036852 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENSCAFT00000036852 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENSCAFT00000036852 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENSCAFT00000036852 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENSCAFT00000036852 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSCAFT00000036852 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSCAFT00000036852 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENSCAFT00000036852 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENSCAFT00000036852 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSCAFT00000036852 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSCAFT00000036852 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSCAFT00000036852 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENSCAFT00000036852 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSCAFT00000036852 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSCAFT00000036852 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSCAFT00000036852 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSCAFT00000036852 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENSCAFT00000036852 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSCAFT00000036852 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] De Rosa MF, et al. (2008) "Inhibition of multidrug resistance by adamantylgb3, a globotriaosylceramide analog." J Biol Chem. 283(8):4501-4511. PMID:18003606
  2. [ + ] Ye S, et al. (2008) "Chemotoxicity of doxorubicin and surface expression of P-glycoprotein (MDR1) is regulated by the Pseudomonas aeruginosa toxin Cif." Am J Physiol Cell Physiol. 295(3):C807-C818. PMID:18650266
  3. [ + ] Fecht S, et al. (2008) "Review of prevalence, genetic aspects and adverse effects of the mdr1-1Delta mutation in dogs." Dtsch Tierarztl Wochenschr. 115(6):212-219. PMID:18605373
  4. [ + ] Lee JY, et al. (2007) "Expression of cyclooxygenase-2, P-glycoprotein and multi-drug resistance-associated protein in canine transitional cell carcinoma." Res Vet Sci. 83(2):210-216. PMID:17316722
  5. [ + ] Matsuura S, et al. (2007) "Induction of chemoresistance in a cultured canine cell line by retroviral transduction of the canine multidrug resistance 1 gene." Am J Vet Res. 68(1):95-100. PMID:17199425
  6. [ + ] Kneuer C, et al. (2007) "Adaptive response to increased bile acids: induction of MDR1 gene expression and P-glycoprotein activity in renal epithelial cells." Pflugers Arch. 454(4):587-594. PMID:17333245
  7. [ + ] Tashbaeva RE, et al. (2007) "Cellular characterization of multidrug resistance P-glycoprotein, alpha fetoprotein, and neovascular endothelium-associated antigens in canine hepatocellular carcinoma and cirrhotic liver." Vet Pathol. 44(5):600-606. PMID:17846232
  8. [ + ] West CL, et al. (2007) "Assessment of antiepileptic drugs as substrates for canine P-glycoprotein." Am J Vet Res. 68(10):1106-1110. PMID:17916018
  9. [ + ] Henik RA, et al. (2006) "Digoxin and mexiletine sensitivity in a Collie with the MDR1 mutation." J Vet Intern Med. 20(2):415-417. PMID:16594604
  10. [ + ] Kamau SW, et al. (2005) "Effect of the modulation of the membrane lipid composition on the localization and function of P-glycoprotein in MDR1-MDCK cells." In Vitro Cell Dev Biol Anim. 41(7):207-216. PMID:16223335
  11. [ + ] Neff MW, et al. (2004) "Breed distribution and history of canine mdr1-1Delta, a pharmacogenetic mutation that marks the emergence of breeds from the collie lineage." Proc Natl Acad Sci U S A. 101(32):11725-11730. PMID:15289602
  12. [ + ] Roulet A, et al. (2003) "MDR1-deficient genotype in Collie dogs hypersensitive to the P-glycoprotein substrate ivermectin." Eur J Pharmacol. 460(2-3):85-91. PMID:12559367
  13. [ + ] Goh LB, et al. (2002) "Endogenous drug transporters in in vitro and in vivo models for the prediction of drug disposition in man." Biochem Pharmacol. 64(11):1569-1578. PMID:12429346
  14. [ + ] Steingold SF, et al. (1998) "Characterization of canine MDR1 mRNA: its abundance in drug resistant cell lines and in vivo." Anticancer Res. 18(1A):393-400. PMID:9568108