ABCC2 | GeneID:403632 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 403632 Official Symbol ABCC2
Locus N/A Gene Type protein-coding
Synonyms MRP2
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Chromosome N/A
Also Known As multidrug resistance protein 2
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68052

ID Symbol Protein Species
GeneID:1244 ABCC2 NP_000383.1 Homo sapiens
GeneID:12780 Abcc2 NP_038834.2 Mus musculus
GeneID:393561 abcc2 NP_956883.1 Danio rerio
GeneID:403632 ABCC2 NP_001003081.1 Canis lupus familiaris
GeneID:423828 ABCC2 XP_421698.2 Gallus gallus
GeneID:450670 ABCC2 XP_507976.2 Pan troglodytes
GeneID:520925 ABCC2 XP_599177.3 Bos taurus
GeneID:818031 ATMRP2 NP_181013.1 Arabidopsis thaliana
GeneID:839920 ATMRP1 NP_001031116.1 Arabidopsis thaliana
GeneID:4337027 Os04g0620000 NP_001053904.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001003081 NP_001003081

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000015149 MI0004748 bta-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSCAFT00000015149 MI0005059 bta-miR-342 UCUCACACAGAAAUCGCACCCAUCU
ENSCAFT00000015149 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSCAFT00000015149 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSCAFT00000015149 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENSCAFT00000015149 MI0005569 hsa-miR-216b AAAUCUCUGCAGGCAAAUGUGA
ENSCAFT00000015149 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSCAFT00000015149 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSCAFT00000015149 MI0000803 hsa-miR-330-5p UCUCUGGGCCUGUGUCUUAGGC
ENSCAFT00000015149 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENSCAFT00000015149 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENSCAFT00000015149 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENSCAFT00000015149 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENSCAFT00000015149 MI0003558 hsa-miR-553 AAAACGGUGAGAUUUUGUUUU
ENSCAFT00000015149 MI0003559 hsa-miR-554 GCUAGUCCUGACUCAGCCAGU
ENSCAFT00000015149 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSCAFT00000015149 MI0003584 hsa-miR-577 UAGAUAAAAUAUUGGUACCUG
ENSCAFT00000015149 MI0003634 hsa-miR-620 AUGGAGAUAGAUAUAGAAAU
ENSCAFT00000015149 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSCAFT00000015149 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSCAFT00000015149 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSCAFT00000015149 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSCAFT00000015149 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENSCAFT00000015149 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENSCAFT00000015149 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSCAFT00000015149 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Conrad S, et al. (2001) "Sequencing and tissue distribution of the canine MRP2 gene compared with MRP1 and MDR1." Toxicology. 156(2-3):81-91. PMID:11164610