ABCC1 | GeneID:403453 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 403453 Official Symbol ABCC1
Locus N/A Gene Type protein-coding
Synonyms MRP1
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 1
Chromosome N/A
Also Known As ATP-binding cassette, sub-family C, member 1; multidrug resistance-associated protein 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55459

ID Symbol Protein Species
GeneID:4363 ABCC1 NP_004987.2 Homo sapiens
GeneID:17250 Abcc1 NP_032602.1 Mus musculus
GeneID:24565 Abcc1 NP_071617.2 Rattus norvegicus
GeneID:34686 MRP NP_995695.1 Drosophila melanogaster
GeneID:180408 mrp-2 NP_508121.1 Caenorhabditis elegans
GeneID:180409 mrp-1 NP_001033553.1 Caenorhabditis elegans
GeneID:281588 ABCC1 NP_776648.1 Bos taurus
GeneID:395416 ABCC1 NP_001012540.1 Gallus gallus
GeneID:403453 ABCC1 NP_001002971.1 Canis lupus familiaris
GeneID:453952 ABCC1 XP_001145351.1 Pan troglodytes
GeneID:839277 ATMRP5 NP_171908.1 Arabidopsis thaliana
GeneID:851713 YCF1 NP_010419.1 Saccharomyces cerevisiae
GeneID:1279254 AgaP_AGAP009835 XP_553715.1 Anopheles gambiae
GeneID:2540937 abc3 NP_595055.1 Schizosaccharomyces pombe
GeneID:2543193 abc2 NP_593943.1 Schizosaccharomyces pombe
GeneID:2679616 MGG_01674 XP_363748.2 Magnaporthe grisea
GeneID:2713263 NCU09012.1 XP_331404.1 Neurospora crassa
GeneID:2895493 KLLA0F20075g XP_455982.1 Kluyveromyces lactis
GeneID:4331585 Os03g0142800 NP_001048934.1 Oryza sativa
GeneID:4623012 AGOS_AGR047W NP_986712.1 Eremothecium gossypii
GeneID:100002010 LOC100002010 XP_001341895.2 Danio rerio

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001002971 NP_001002971

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000028933 MI0005057 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000028933 MI0005451 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000028933 MI0005452 bta-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSCAFT00000028933 MI0005453 bta-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSCAFT00000028933 MI0005454 bta-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSCAFT00000028933 MI0005026 bta-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSCAFT00000028933 MI0005025 bta-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENSCAFT00000028933 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSCAFT00000028933 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENSCAFT00000028933 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSCAFT00000028933 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000028933 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENSCAFT00000028933 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENSCAFT00000028933 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSCAFT00000028933 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENSCAFT00000028933 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENSCAFT00000028933 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSCAFT00000028933 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSCAFT00000028933 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENSCAFT00000028933 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSCAFT00000028933 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Westlake CJ, et al. (2004) "Identification and characterization of functionally important elements in the multidrug resistance protein 1 COOH-terminal region." J Biol Chem. 279(51):53571-53583. PMID:15459206
  2. [ + ] Ma L, et al. (2002) "Identification and characterization of the canine multidrug resistance-associated protein." Mol Cancer Ther. 1(14):1335-1342. PMID:12516967