BRCA1 | GeneID:403437 | Canis lupus familiaris

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 403437 Official Symbol BRCA1
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description breast cancer 1, early onset
Chromosome N/A
Also Known As BRCA1 homolog; breast and ovarian cancer susceptibility protein 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5276

ID Symbol Protein Species
GeneID:672 BRCA1 NP_009233.1 Homo sapiens
GeneID:12189 Brca1 NP_033894.2 Mus musculus
GeneID:353120 BRCA1 NP_848668.1 Bos taurus
GeneID:373983 BRCA1 NP_989500.1 Gallus gallus
GeneID:403437 BRCA1 NP_001013434.1 Canis lupus familiaris
GeneID:449497 BRCA1 XP_001157352.1 Pan troglodytes
GeneID:497672 Brca1 NP_036646.1 Rattus norvegicus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab17251 BRCA1 antibody [GLK-2] (ab17251); Mouse monoclonal [GLK-2] to BRCA1

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001013416 NP_001013434

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSCAFT00000023190 MI0004752 bta-miR-125a UCCCUGAGACCCUUUAACCUGUG
ENSCAFT00000023190 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSCAFT00000023190 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENSCAFT00000023190 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENSCAFT00000023190 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSCAFT00000023190 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENSCAFT00000023190 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENSCAFT00000023190 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSCAFT00000023190 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSCAFT00000023190 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSCAFT00000023190 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENSCAFT00000023190 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000023190 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000023190 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSCAFT00000023190 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENSCAFT00000023190 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENSCAFT00000023190 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSCAFT00000023190 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSCAFT00000023190 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000023190 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSCAFT00000023190 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sugiura T, et al. (2007) "Expression patterns of the BRCA1 splicing variants in canine normal tissues and mammary gland tumors." J Vet Med Sci. 69(6):587-592. PMID:17611353
  2. [ + ] Gray IS, et al. (2000) "A single nucleotide (T-->G) polymorphism within intron 23 of the canine BRCA1 gene." Anim Genet. 31(1):76-77. PMID:10690375
  3. [ + ] Szabo CI, et al. (1996) "Human, canine and murine BRCA1 genes: sequence comparison among species." Hum Mol Genet. 5(9):1289-1298. PMID:8872468