ACCN1 | GeneID:40 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 40 Official Symbol ACCN1
Locus N/A Gene Type protein-coding
Synonyms ACCN; ASIC2; ASIC2a; BNC1; BNaC1; MDEG; hBNaC1
Full Name amiloride-sensitive cation channel 1, neuronal
Description amiloride-sensitive cation channel 1, neuronal
Chromosome 17q12
Also Known As degenerin; neuronal amiloride-sensitive cation channel 1
Summary This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and ACCN3 (variant 1) has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37439

ID Symbol Protein Species
GeneID:40 ACCN1 NP_899233.1 Homo sapiens
GeneID:11418 Accn1 NP_031410.1 Mus musculus
GeneID:491150 ACCN1 XP_548270.2 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65699 ACCN1 antibody (ab65699); Rabbit polyclonal to ACCN1
2 abcam ab42635 ACCN1 antibody (ab42635); Rabbit polyclonal to ACCN1
3 scbt ACCN1 ACCN1 Antibody / ACCN1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACCN1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACCN1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005216 Function ion channel activity
GO:0005515 Function protein binding
GO:0031402 Function sodium ion binding
GO:0007417 Process central nervous system development
GO:0006811 Process ion transport
GO:0007422 Process peripheral nervous system development
GO:0006814 Process sodium ion transport
GO:0007268 Process synaptic transmission

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001094  UCSC Browser NP_001085
2 NM_183377  UCSC Browser NP_899233

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000225823 MI0000113 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC
ENST00000225823 MI0000459 hsa-miR-143* GGUGCAGUGCUGCAUCUCUGGU
ENST00000225823 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000225823 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000225823 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000225823 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000225823 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000225823 MI0001448 hsa-miR-425 AAUGACACGAUCACUCCCGUUGA
ENST00000225823 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000225823 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000225823 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000225823 MI0003123 hsa-miR-488* CCCAGAUAAUGGCACUCUCAA
ENST00000225823 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENST00000225823 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000225823 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENST00000225823 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000225823 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000225823 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000225823 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000225823 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000225823 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000225823 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000225823 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000225823 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000225823 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000225823 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000225823 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENST00000225823 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000359872 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000359872 MI0000113 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC
ENST00000359872 MI0000455 hsa-miR-138-2* GCUAUUUCACGACACCAGGGUU
ENST00000359872 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000359872 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000359872 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000359872 MI0003123 hsa-miR-488* CCCAGAUAAUGGCACUCUCAA
ENST00000359872 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENST00000359872 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000359872 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000359872 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000359872 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AK127748   AK313043   AL834182   BC075042   BC075043   EU446513   NM_001094   NM_183377   U50352   U53212   U57352  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACCN1 mRNA
16644059
Estradiol
  • Estradiol affects the expression of ACCN1 mRNA
15598610
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ACCN1 mRNA
12075121

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 16919318, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 12948864, 17018787, 18497071, 17261762
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 16891317, 11408345, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 16050911, 15673190, 16097048, 10355542, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 16239168, 12795759, 12631006, 61145, 17595544, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16177239, 16227642, 15027814, 15968718, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17557913, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17805973, 16116963, 15925388, 16248980, 17525996
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15830285, 15720792, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACCN3 ACCN1 / ACCN3 Affinity Capture-Western Babinski K (2000)
Prkcabp ACCN1 / Prkcabp Affinity Capture-Western Duggan A (2002)
STOML1 STOML1 / ACCN1 Affinity Capture-Western Price MP (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Chai S, et al. (2007) "A kinase-anchoring protein 150 and calcineurin are involved in regulation of acid-sensing ion channels ASIC1a and ASIC2a." J Biol Chem. 282(31):22668-22677. PMID:17548344
  2. [ + ] Bernardinelli L, et al. (2007) "Association between the ACCN1 gene and multiple sclerosis in Central East Sardinia." PLoS ONE. 2(5):e480. PMID:17534430
  3. [ + ] Stone JL, et al. (2007) "High density SNP association study of a major autism linkage region on chromosome 17." Hum Mol Genet. 16(6):704-715. PMID:17376794
  4. [ + ] Joch M, et al. (2007) "Parkin-mediated monoubiquitination of the PDZ protein PICK1 regulates the activity of acid-sensing ion channels." Mol Biol Cell. 18(8):3105-3118. PMID:17553932
  5. [ + ] Vila-Carriles WH, et al. (2006) "Surface expression of ASIC2 inhibits the amiloride-sensitive current and migration of glioma cells." J Biol Chem. 281(28):19220-19232. PMID:16704974
  6. [ + ] Saugstad JA, et al. (2004) "Analysis of the membrane topology of the acid-sensing ion channel 2a." J Biol Chem. 279(53):55514-55519. PMID:15504740
  7. [ + ] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  10. [ + ] Duggan A, et al. (2002) "The PDZ domain protein PICK1 and the sodium channel BNaC1 interact and localize at mechanosensory terminals of dorsal root ganglion neurons and dendrites of central neurons." J Biol Chem. 277(7):5203-5208. PMID:11739374
  11. [ + ] Hruska-Hageman AM, et al. (2002) "Interaction of the synaptic protein PICK1 (protein interacting with C kinase 1) with the non-voltage gated sodium channels BNC1 (brain Na+ channel 1) and ASIC (acid-sensing ion channel)." Biochem J. 361(Pt 3):443-450. PMID:11802773
  12. [ + ] Babinski K, et al. (2000) "Mammalian ASIC2a and ASIC3 subunits co-assemble into heteromeric proton-gated channels sensitive to Gd3+." J Biol Chem. 275(37):28519-28525. PMID:10842183
  13. [ + ] Bassilana F, et al. (1997) "The acid-sensitive ionic channel subunit ASIC and the mammalian degenerin MDEG form a heteromultimeric H+-gated Na+ channel with novel properties." J Biol Chem. 272(46):28819-28822. PMID:9360943
  14. [ + ] Garcia-Anoveros J, et al. (1997) "BNaC1 and BNaC2 constitute a new family of human neuronal sodium channels related to degenerins and epithelial sodium channels." Proc Natl Acad Sci U S A. 94(4):1459-1464. PMID:9037075
  15. [ + ] Price MP, et al. (1996) "Cloning and expression of a novel human brain Na+ channel." J Biol Chem. 271(14):7879-7882. PMID:8626462
  16. [ + ] Waldmann R, et al. (1996) "The human degenerin MDEG, an amiloride-sensitive neuronal cation channel, is localized on chromosome 17q11.2-17q12 close to the microsatellite D17S798." Genomics. 37(2):269-270. PMID:8921408
  17. [ + ] Waldmann R, et al. (1996) "The mammalian degenerin MDEG, an amiloride-sensitive cation channel activated by mutations causing neurodegeneration in Caenorhabditis elegans." J Biol Chem. 271(18):10433-10436. PMID:8631835