FREQ | GeneID:396336 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 396336 Official Symbol FREQ
Locus N/A Gene Type protein-coding
Synonyms NCS-1
Full Name frequenin homolog (Drosophila)
Description frequenin homolog (Drosophila)
Chromosome N/A
Also Known As frequenin homolog; neuronal calcium sensor homologue
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5719

ID Symbol Protein Species
GeneID:14299 Freq NP_062655.1 Mus musculus
GeneID:23413 FREQ NP_055101.2 Homo sapiens
GeneID:32797 Frq1 NP_573271.1 Drosophila melanogaster
GeneID:32799 Frq2 NP_525093.1 Drosophila melanogaster
GeneID:65153 Freq NP_077342.1 Rattus norvegicus
GeneID:180448 ncs-1 NP_508186.1 Caenorhabditis elegans
GeneID:396336 FREQ NP_990708.1 Gallus gallus
GeneID:491294 FREQ XP_548415.2 Canis lupus familiaris
GeneID:526544 FREQ NP_001035637.1 Bos taurus
GeneID:553174 freqb NP_001018350.1 Danio rerio
GeneID:1278632 AgaP_ENSANGG00000017071 XP_318275.1 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abgent AP1551c NCS1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030424 Component axon
GO:0030054 Component cell junction
GO:0030425 Component dendrite
GO:0005794 Component Golgi apparatus
GO:0032580 Component Golgi cisterna membrane
GO:0005886 Component plasma membrane
GO:0014069 Component postsynaptic density
GO:0045211 Component postsynaptic membrane
GO:0045202 Component synapse
GO:0005509 Function calcium ion binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_205377 NP_990708

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000020749 MI0001191 gga-miR-138 AGCUGGUGUUGUGAAUC
ENSGALT00000020749 MI0001228 gga-miR-138 AGCUGGUGUUGUGAAUC
ENSGALT00000020749 MI0001278 gga-miR-183 UAUGGCACUGGUAGAAUUCACUG
ENSGALT00000020749 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENSGALT00000020749 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENSGALT00000020749 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSGALT00000020749 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENSGALT00000020749 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENSGALT00000020749 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSGALT00000020749 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENSGALT00000020749 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000020749 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENSGALT00000020749 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENSGALT00000020749 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSGALT00000020749 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSGALT00000020749 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENSGALT00000020749 MI0003667 hsa-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSGALT00000020749 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSGALT00000020749 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSGALT00000020749 MI0005567 hsa-miR-760 CGGCUCUGGGUCUGUGGGGA
ENSGALT00000020749 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSGALT00000020749 MI0005527 hsa-miR-886-5p CGGGUCGGAGUUAGCUCAAGCGG
ENSGALT00000020749 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSGALT00000020749 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSGALT00000020749 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSGALT00000020749 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSGALT00000020749 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSGALT00000020749 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSGALT00000020749 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSGALT00000020749 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA
ENSGALT00000020749 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSGALT00000020749 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

BX934267   L27420   NM_205377  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] De Castro E, et al. (1995) "Regulation of rhodopsin phosphorylation by a family of neuronal calcium sensors." Biochem Biophys Res Commun. 216(1):133-140. PMID:7488079
  2. [ + ] Nef S, et al. (1995) "Identification of neuronal calcium sensor (NCS-1) possibly involved in the regulation of receptor phosphorylation." J Recept Signal Transduct Res. 15(1-4):365-378. PMID:8903951