A2M | GeneID:396151 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 396151 Official Symbol A2M
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha-2-macroglobulin
Chromosome N/A
Also Known As ovomacroglobulin, ovostatin
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45969

ID Symbol Protein Species
GeneID:144203 OVOS2 NP_001073971.1 Homo sapiens
GeneID:232400 BC048546 NP_001001179.1 Mus musculus
GeneID:362442 RGD1565709 XP_342765.3 Rattus norvegicus
GeneID:396151 A2M NP_990557.1 Gallus gallus
GeneID:408186 OVOS XP_001715949.1 Homo sapiens
GeneID:425757 LOC425757 XP_423478.2 Gallus gallus
GeneID:508026 OVOS2 XP_584745.3 Bos taurus
GeneID:611455 LOC611455 XP_854216.1 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0005615 Component extracellular space
GO:0005515 Function protein binding
GO:0004867 Function serine-type endopeptidase inhibitor activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_205226 NP_990557

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000037194 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSGALT00000037194 MI0003705 gga-miR-375 UUUGUUCGUUCGGCUCGCGUUA
ENSGALT00000037194 MI0003708 gga-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSGALT00000037194 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENSGALT00000037194 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSGALT00000037194 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENSGALT00000037194 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSGALT00000037194 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000037194 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSGALT00000037194 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSGALT00000037194 MI0003164 hsa-miR-520d-5p CUACAAAGGGAAGCCCUUUC
ENSGALT00000037194 MI0003160 hsa-miR-524-5p CUACAAAGGGAAGCACUUUCUC
ENSGALT00000037194 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSGALT00000037194 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENSGALT00000037194 MI0003633 hsa-miR-619 GACCUGGACAUGUUUGUGCCCAGU
ENSGALT00000037194 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSGALT00000037194 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSGALT00000037194 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSGALT00000037194 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_205226   X78801  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Nielsen KL, et al. (1994) "Amino acid sequence of hen ovomacroglobulin (ovostatin) deduced from cloned cDNA." DNA Seq. 5(2):111-119. PMID:7535598
  2. [ + ] Nielsen KL, et al. (1993) "Evidence from sequence analysis that hen egg-white ovomacroglobulin (ovostatin) is devoid of an internal beta-Cys-gamma-Glu thiol ester." Biochim Biophys Acta. 1162(1-2):230-232. PMID:7680577
  3. [ + ] Enghild JJ, et al. (1989) "Interaction of human rheumatoid synovial collagenase (matrix metalloproteinase 1) and stromelysin (matrix metalloproteinase 3) with human alpha 2-macroglobulin and chicken ovostatin. Binding kinetics and identification of matrix metalloproteinase cleavage sites." J Biol Chem. 264(15):8779-8785. PMID:2470748
  4. [ + ] Nagase H, et al. (1983) "Ovostatin: a novel proteinase inhibitor from chicken egg white. I. Purification, physicochemical properties, and tissue distribution of ovostatin." J Biol Chem. 258(12):7481-7489. PMID:6408074