AANAT | GeneID:396066 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 396066 Official Symbol AANAT
Locus N/A Gene Type protein-coding
Synonyms
Full Name arylalkylamine N-acetyltransferase
Description arylalkylamine N-acetyltransferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0008415 Function acyltransferase activity
GO:0004059 Function aralkylamine N-acetyltransferase activity
GO:0004060 Function arylamine N-acetyltransferase activity
GO:0005184 Function neuropeptide hormone activity
GO:0016740 Function transferase activity
GO:0030187 Process melatonin biosynthetic process
GO:0008152 Process metabolic process
GO:0048511 Process rhythmic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_205158 NP_990489

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000003024 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSGALT00000003024 MI0005040 bta-miR-214 ACAGCAGGCACAGACAGGCAGU
ENSGALT00000003024 MI0005463 bta-miR-331 GCCCCUGGGCCUAUCCUAGAA
ENSGALT00000003024 MI0005019 bta-miR-345 GCUGACUCCUAGUCCAGUGCU
ENSGALT00000003024 MI0001238 gga-miR-205b CCCUUCAUUCCACCGGAAUCUG
ENSGALT00000003024 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSGALT00000003024 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSGALT00000003024 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSGALT00000003024 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSGALT00000003024 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSGALT00000003024 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENSGALT00000003024 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSGALT00000003024 MI0003577 hsa-miR-570 CGAAAACAGCAAUUACCUUUGC
ENSGALT00000003024 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSGALT00000003024 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSGALT00000003024 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSGALT00000003024 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSGALT00000003024 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSGALT00000003024 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENSGALT00000003024 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENSGALT00000003024 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSGALT00000003024 MI0005416 hsa-miR-675 UGGUGCGGAGAGGGCCCACAGUG
ENSGALT00000003024 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSGALT00000003024 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENSGALT00000003024 MI0005761 hsa-miR-939 UGGGGAGCUGAGGCUCUGGGGGUG
ENSGALT00000003024 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENSGALT00000003024 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSGALT00000003024 MI0004601 mmu-miR-673-5p CUCACAGCUCUGGUCCUUGGAG
ENSGALT00000003024 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSGALT00000003024 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_205158   U46502  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235
  2. [ + ] Toller GL, et al. (2006) "Circadian expression of Bmal1 and serotonin-N-acetyltransferase mRNAs in chicken retina cells and pinealocytes in vivo and in vitro." J Mol Neurosci. 28(2):143-150. PMID:16679554
  3. [ + ] Bernard M, et al. (1997) "Avian melatonin synthesis: photic and circadian regulation of serotonin N-acetyltransferase mRNA in the chicken pineal gland and retina." J Neurochem. 68(1):213-224. PMID:8978728