ABCB1 | GeneID:395712 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 395712 Official Symbol ABCB1
Locus N/A Gene Type protein-coding
Synonyms ABCB4; CMDR1
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 1
Chromosome N/A
Also Known As ABC transporter protein; ATP-binding cassette, sub-family B (MDR/TAP), member 4; ATP-binding cassette, subfamily B, member 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55496

ID Symbol Protein Species
GeneID:5243 ABCB1 NP_000918.2 Homo sapiens
GeneID:18671 Abcb1a NP_035206.1 Mus musculus
GeneID:36582 Mdr50 NP_523740.3 Drosophila melanogaster
GeneID:170913 Abcb1 NP_596892.1 Rattus norvegicus
GeneID:178215 pgp-1 NP_502413.1 Caenorhabditis elegans
GeneID:180165 pgp-9 NP_507487.1 Caenorhabditis elegans
GeneID:281585 ABCB1 XP_590317.3 Bos taurus
GeneID:395712 ABCB1 NP_990225.1 Gallus gallus
GeneID:403879 ABCB1 NP_001003215.1 Canis lupus familiaris
GeneID:420534 ABCB4 XP_418636.2 Gallus gallus
GeneID:463516 ABCB1 XP_001163342.1 Pan troglodytes
GeneID:822463 AT3G28345 NP_189475.1 Arabidopsis thaliana
GeneID:822465 PGP16 NP_189477.1 Arabidopsis thaliana
GeneID:822467 PGP17 NP_189479.1 Arabidopsis thaliana
GeneID:822468 PGP18 NP_189480.1 Arabidopsis thaliana
GeneID:822471 AT3G28415 NP_683599.1 Arabidopsis thaliana
GeneID:2538709 pmd1 NP_588265.1 Schizosaccharomyces pombe
GeneID:2675205 MGG_00141 XP_369103.2 Magnaporthe grisea
GeneID:4328568 Os02g0190000 NP_001046147.1 Oryza sativa
GeneID:4328570 Os02g0190300 NP_001046148.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_204894 NP_990225

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000014493 MI0001170 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000014493 MI0006985 gga-miR-33 GUGCAUUGUAGUUGCAUUGC
ENSGALT00000014493 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSGALT00000014493 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000014493 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000014493 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSGALT00000014493 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSGALT00000014493 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENSGALT00000014493 MI0003674 hsa-miR-653 GUGUUGAAACAAUCUCUACUG
ENSGALT00000014493 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Yamada K, et al. (2007) "Development of multidrug resistance type I Cmdr1 expression in chicken embryonic gonads." Comp Biochem Physiol A Mol Integr Physiol. 147(4):928-933. PMID:17383916
  2. [ + ] Edelmann HM, et al. (1999) "Cmdr1, a chicken P-glycoprotein, confers multidrug resistance and interacts with estradiol." Biol Chem. 380(2):231-241. PMID:10195430