acadl | GeneID:394156 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 394156 Official Symbol acadl
Locus CH211-12A1.2 Gene Type protein-coding
Synonyms MGC55656; zgc:55656
Full Name acyl-Coenzyme A dehydrogenase, long chain
Description acyl-Coenzyme A dehydrogenase, long chain
Chromosome N/A
Also Known As LCAD; long-chain acyl-CoA dehydrogenase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37498

ID Symbol Protein Species
GeneID:33 ACADL NP_001599.1 Homo sapiens
GeneID:11363 Acadl NP_031407.2 Mus musculus
GeneID:25287 Acadl NP_036951.1 Rattus norvegicus
GeneID:394156 acadl NP_957475.1 Danio rerio
GeneID:424005 ACADL NP_001006511.1 Gallus gallus
GeneID:459914 ACADL XP_516063.2 Pan troglodytes
GeneID:478895 ACADL XP_536053.2 Canis lupus familiaris
GeneID:614508 ACADL NP_001070404.1 Bos taurus
GeneID:100150734 LOC100150734 XP_001922695.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0008152 Process metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_201181 NP_957475

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000098305 MI0001994 dre-miR-133b* GCUGGUCAAAUGGAACCAAGUC
ENSDART00000098305 MI0002041 dre-miR-203b GUGAAAUGUUCAGGACCACUUG
ENSDART00000098305 MI0002048 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000098305 MI0002049 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000098305 MI0001387 dre-miR-221 AGCUACAUUGUCUGCUGGGUUUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932