acad8 | GeneID:394130 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 394130 Official Symbol acad8
Locus N/A Gene Type protein-coding
Synonyms MGC55874; zgc:55874
Full Name acyl-Coenzyme A dehydrogenase family, member 8
Description acyl-Coenzyme A dehydrogenase family, member 8
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 8662

ID Symbol Protein Species
GeneID:27034 ACAD8 NP_055199.1 Homo sapiens
GeneID:66948 Acad8 NP_080138.2 Mus musculus
GeneID:173466 F28A10.6 NP_493832.1 Caenorhabditis elegans
GeneID:394130 acad8 NP_957449.1 Danio rerio
GeneID:419739 ACAD8 XP_417879.2 Gallus gallus
GeneID:451683 ACAD8 XP_508872.2 Pan troglodytes
GeneID:479386 ACAD8 XP_536524.2 Canis lupus familiaris
GeneID:512070 ACAD8 NP_001069019.1 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0008152 Process metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_201155 NP_957449

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000062569 MI0002010 dre-miR-145 GUCCAGUUUUCCCAGGAAUCCC
ENSDART00000062569 MI0002026 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000062569 MI0003243 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000062569 MI0002048 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000062569 MI0002049 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000062569 MI0002051 dre-miR-218a UUGUGCUUGAUCUAACCAUGUG
ENSDART00000062569 MI0002052 dre-miR-218a UUGUGCUUGAUCUAACCAUGUG
ENSDART00000062569 MI0002053 dre-miR-218b UUGUGCUUGAUCUAACCAUGCA
ENSDART00000062569 MI0001917 dre-miR-23b AUCACAUUGCCAGGGAUUACCA
ENSDART00000062569 MI0001527 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002111 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002112 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002113 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002114 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002115 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002116 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002117 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002118 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002119 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002120 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002121 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002122 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002123 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002124 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002125 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002126 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002131 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002132 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002133 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002134 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002135 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002138 dre-miR-430a UAAGUGCUAUUUGUUGGGGUAG
ENSDART00000062569 MI0002139 dre-miR-430i UAAGUGCUAUUUGUUGGCGUAG
ENSDART00000062569 MI0002140 dre-miR-430i UAAGUGCUAUUUGUUGGCGUAG
ENSDART00000062569 MI0002141 dre-miR-430i UAAGUGCUAUUUGUUGGCGUAG
ENSDART00000062569 MI0002180 dre-miR-459 UCAGUAACAAGGAUUCAUCCUG
ENSDART00000062569 MI0004878 xtr-miR-302 UAAGUGCUCCAAUGUUUUAGUGG
ENSDART00000062569 MI0004882 xtr-miR-425-5p AAUGACACGAUCACUCCCGUUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAH44203   AAH66503   NP_957449   Q6NYQ3   Q7ZYY0  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932