abi1 | GeneID:393711 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 393711 Official Symbol abi1
Locus N/A Gene Type protein-coding
Synonyms MGC73174; wu:fc66g09; wu:fk56a10; zgc:73174
Full Name abl-interactor 1
Description abl-interactor 1
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_200738 NP_957032

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000031245 MI0001380 dre-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSDART00000031245 MI0001366 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000031245 MI0001367 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000031245 MI0002024 dre-miR-181c CACAUUCAUUGCUGUCGGUGGG
ENSDART00000031245 MI0004957 xtr-miR-449 AGGCAGUGUAAUGUUAGCUGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932