aanat1 | GeneID:393677 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 393677 Official Symbol aanat1
Locus N/A Gene Type protein-coding
Synonyms MGC73074; zgc:73074
Full Name arylalkylamine N-acetyltransferase 1
Description arylalkylamine N-acetyltransferase 1
Chromosome N/A
Also Known As arylalkylamine N-acetyltransferase
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 31013

ID Symbol Protein Species
GeneID:15 AANAT NP_001079.1 Homo sapiens
GeneID:11298 Aanat NP_033721.1 Mus musculus
GeneID:25120 Aanat NP_036950.1 Rattus norvegicus
GeneID:281583 AANAT NP_803475.1 Bos taurus
GeneID:393677 aanat1 NP_956998.1 Danio rerio
GeneID:396066 AANAT NP_990489.1 Gallus gallus
GeneID:483331 AANAT XP_540450.1 Canis lupus familiaris
GeneID:503504 AANAT NP_001012442.1 Pan troglodytes
GeneID:618594 AANAT XP_876019.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016407 Function acetyltransferase activity
GO:0008415 Function acyltransferase activity
GO:0004059 Function aralkylamine N-acetyltransferase activity
GO:0008080 Function N-acetyltransferase activity
GO:0016740 Function transferase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_200704 NP_956998

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000053126 MI0001868 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000053126 MI0001870 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000053126 MI0001875 dre-let-7h UGAGGUAGUAAGUUGUGUUGUU
ENSDART00000053126 MI0001877 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000053126 MI0001878 dre-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENSDART00000053126 MI0002040 dre-miR-202 AGAGGCAUAGGGCAUGGGAAAA
ENSDART00000053126 MI0002041 dre-miR-203b GUGAAAUGUUCAGGACCACUUG
ENSDART00000053126 MI0001378 dre-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSDART00000053126 MI0001910 dre-miR-22a AAGCUGCCAGCUGAAGAACUGU
ENSDART00000053126 MI0001911 dre-miR-22a AAGCUGCCAGCUGAAGAACUGU
ENSDART00000053126 MI0001912 dre-miR-22b AAGCUGCCAGUUGAAGAGCUGU
ENSDART00000053126 MI0001928 dre-miR-27a UUCACAGUGGCUAAGUUCCGCU
ENSDART00000053126 MI0001929 dre-miR-27b UUCACAGUGGCUAAGUUCUGCA
ENSDART00000053126 MI0001930 dre-miR-27c UUCACAGUGGUUAAGUUCUGC
ENSDART00000053126 MI0001931 dre-miR-27d UUCACAGUGGCUAAGUUCUUCA
ENSDART00000053126 MI0001932 dre-miR-27e UUCACAGUGGCUAAGUUCAGUG
ENSDART00000053126 MI0004951 xtr-miR-208 AUAAGACGAGCAUAAAGCUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Klein DC, et al. (2007) "Arylalkylamine N-acetyltransferase: "the Timezyme"." J Biol Chem. 282(7):4233-4237. PMID:17164235
  2. [ + ] Zilberman-Peled B, et al. (2006) "A possible new role for fish retinal serotonin-N-acetyltransferase-1 (AANAT1): Dopamine metabolism." Brain Res. 1073-1074():220-228. PMID:16427617
  3. [ + ] Appelbaum L, et al. (2006) "Zebrafish arylalkylamine-N-acetyltransferase genes - targets for regulation of the circadian clock." J Mol Endocrinol. 36(2):337-347. PMID:16595704
  4. [ + ] Zilberman-Peled B, et al. (2004) "Duality of serotonin-N-acetyltransferase in the gilthead seabream (Sparus aurata): molecular cloning and characterization of recombinant enzymes." Gen Comp Endocrinol. 138(2):139-147. PMID:15302263
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932