abcc2 | GeneID:393561 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 393561 Official Symbol abcc2
Locus N/A Gene Type protein-coding
Synonyms MGC66072; zgc:66072
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68052

ID Symbol Protein Species
GeneID:1244 ABCC2 NP_000383.1 Homo sapiens
GeneID:12780 Abcc2 NP_038834.2 Mus musculus
GeneID:393561 abcc2 NP_956883.1 Danio rerio
GeneID:403632 ABCC2 NP_001003081.1 Canis lupus familiaris
GeneID:423828 ABCC2 XP_421698.2 Gallus gallus
GeneID:450670 ABCC2 XP_507976.2 Pan troglodytes
GeneID:520925 ABCC2 XP_599177.3 Bos taurus
GeneID:818031 ATMRP2 NP_181013.1 Arabidopsis thaliana
GeneID:839920 ATMRP1 NP_001031116.1 Arabidopsis thaliana
GeneID:4337027 Os04g0620000 NP_001053904.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_200589 NP_956883

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000016604 MI0001857 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000016604 MI0001858 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000016604 MI0001860 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000016604 MI0001861 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000016604 MI0001862 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000016604 MI0001863 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000016604 MI0001866 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000016604 MI0001867 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000016604 MI0001871 dre-let-7e UGAGGUAGUAGAUUGAAUAGUU
ENSDART00000016604 MI0001872 dre-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENSDART00000016604 MI0002005 dre-miR-142a-3p UGUAGUGUUUCCUACUUUAUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932