acad11 | GeneID:393147 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 393147 Official Symbol acad11
Locus N/A Gene Type protein-coding
Synonyms MGC55835; zgc:55835
Full Name acyl-Coenzyme A dehydrogenase family, member 11
Description acyl-Coenzyme A dehydrogenase family, member 11
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 49896

ID Symbol Protein Species
GeneID:84129 ACAD11 NP_115545.3 Homo sapiens
GeneID:102632 Acad11 NP_780533.2 Mus musculus
GeneID:315973 Acad11 XP_236582.4 Rattus norvegicus
GeneID:393147 acad11 NP_956472.1 Danio rerio
GeneID:420689 ACAD11 NP_001006367.1 Gallus gallus
GeneID:526956 ACAD11 NP_001069361.1 Bos taurus
GeneID:2678943 MGG_08661 XP_363077.1 Magnaporthe grisea
GeneID:2708409 NCU01181.1 XP_326674.1 Neurospora crassa
GeneID:2894198 KLLA0E15246g XP_454634.1 Kluyveromyces lactis
GeneID:4621561 AGOS_AFL213W NP_985337.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0005524 Function ATP binding
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0016491 Function oxidoreductase activity
GO:0016627 Function oxidoreductase activity, acting on the CH-CH group of donors
GO:0004713 Function protein tyrosine kinase activity
GO:0008152 Process metabolic process
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_200178 NP_956472

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000066778 MI0001857 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000066778 MI0001858 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000066778 MI0001860 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000066778 MI0001861 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000066778 MI0001862 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000066778 MI0001863 dre-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENSDART00000066778 MI0001865 dre-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENSDART00000066778 MI0001866 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000066778 MI0001867 dre-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSDART00000066778 MI0001868 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000066778 MI0001870 dre-let-7d UGAGGUAGUUGGUUGUAUGGUU
ENSDART00000066778 MI0003343 dre-let-7j UGAGGUAGUUGUUUGUACAGUU
ENSDART00000066778 MI0002005 dre-miR-142a-3p UGUAGUGUUUCCUACUUUAUGGA
ENSDART00000066778 MI0002005 dre-miR-142a-5p CAUAAAGUAGAAAGCACUACU
ENSDART00000066778 MI0002006 dre-miR-142b-5p CAUAAAGUAGACAGCACUACUA
ENSDART00000066778 MI0001372 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000066778 MI0002035 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000066778 MI0002036 dre-miR-196b UAGGUAGUUUCAAGUUGUUGGG
ENSDART00000066778 MI0001373 dre-miR-199* UACAGUAGUCUGCACAUUGGUU
ENSDART00000066778 MI0001374 dre-miR-199* UACAGUAGUCUGCACAUUGGUU
ENSDART00000066778 MI0001903 dre-miR-19a* CUAGUUUUGCAUAGUUGCACUA
ENSDART00000066778 MI0001904 dre-miR-19b* AGUUUUGCUGGUUUGCAUUCAG
ENSDART00000066778 MI0001383 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000066778 MI0002050 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000066778 MI0001913 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000066778 MI0001915 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000066778 MI0001916 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000066778 MI0001917 dre-miR-23b AUCACAUUGCCAGGGAUUACCA
ENSDART00000066778 MI0001922 dre-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSDART00000066778 MI0002067 dre-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSDART00000066778 MI0004767 dre-miR-723* GACAGUUUUAAAUGAUGUUACUUU
ENSDART00000066778 MI0001951 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000066778 MI0001952 dre-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENSDART00000066778 MI0001953 dre-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENSDART00000066778 MI0004880 xtr-miR-367 AAUUGCACUGUAGCAAUGGUGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932