ACAT2 | GeneID:39 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 39 Official Symbol ACAT2
Locus N/A Gene Type protein-coding
Synonyms
Full Name acetyl-Coenzyme A acetyltransferase 2
Description acetyl-Coenzyme A acetyltransferase 2
Chromosome 6q25.3
Also Known As OTTHUMP00000017527; acetoacetyl Coenzyme A thiolase; cytosolic acetoacetyl-CoA thiolase
Summary The product of this gene is an enzyme involved in lipid metabolism, and it encodes cytosolic acetoacetyl-CoA thiolase. This gene shows complementary overlapping with the 3-prime region of the TCP1 gene in both mouse and human. These genes are encoded on opposite strands of DNA, as well as in opposite transcriptional orientation. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55855

ID Symbol Protein Species
GeneID:39 ACAT2 NP_005882.2 Homo sapiens
GeneID:30643 acat2 NP_571445.2 Danio rerio
GeneID:38147 CG9149 NP_612094.2 Drosophila melanogaster
GeneID:110460 Acat2 NP_033364.1 Mus musculus
GeneID:224530 Acat3 NP_694791.2 Mus musculus
GeneID:308100 Acat2 NP_001006996.1 Rattus norvegicus
GeneID:421587 ACAT2 NP_001034376.1 Gallus gallus
GeneID:484063 ACAT2 XP_541180.2 Canis lupus familiaris
GeneID:512044 ACAT2 NP_001069017.1 Bos taurus
GeneID:1281861 AgaP_AGAP001318 XP_321828.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab66259 ACAT2 antibody (ab66259); Rabbit polyclonal to ACAT2
2 abcam ab37467 ACAT2 antibody (ab37467); Rabbit polyclonal to ACAT2 - Azide free
3 abcam ab60282 ACAT2 antibody (ab60282); Chicken polyclonal to ACAT2
4 abnova H00000039-M01 ACAT2 monoclonal antibody (M01), clone 4A5; Mouse monoclonal antibody raised against a full-length recombinant ACAT2.
5 acris AP17076PU-N ACAT2 / ACTL (N-term); antibody Ab
6 acris AP17075PU-N ACAT2 / ACTL (Center); antibody Ab
7 scbt ACAT2 ACAT2 Antibody / ACAT2 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAT2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAT2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0003985 Function acetyl-CoA C-acetyltransferase activity
GO:0008415 Function acyltransferase activity
GO:0005515 Function protein binding
GO:0016740 Function transferase activity
GO:0006629 Process lipid metabolic process
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_005891  UCSC Browser NP_005882

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000367048 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000367048 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000367048 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000367048 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000367048 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENST00000367048 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENST00000367048 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000367048 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000367048 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000367048 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000367048 MI0000744 hsa-miR-299-3p UAUGUGGGAUGGUAAACCGCUU
ENST00000367048 MI0000087 hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENST00000367048 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000367048 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000367048 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000367048 MI0005568 hsa-miR-301b CAGUGCAAUGAUAUUGUCAAAGC
ENST00000367048 MI0000090 hsa-miR-32 UAUUGCACAUUACUAAGUUGCA
ENST00000367048 MI0000764 hsa-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENST00000367048 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENST00000367048 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000367048 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000367048 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000367048 MI0003136 hsa-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENST00000367048 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000367048 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000367048 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000367048 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000367048 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000367048 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000367048 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000367048 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000367048 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000367048 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000367048 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENST00000367048 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENST00000367048 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENST00000367048 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENST00000367048 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000367048 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000367048 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENST00000367048 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENST00000367048 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000367048 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000367048 MI0003757 hsa-miR-758 UUUGUGACCUGGUCCACUAACC
ENST00000367048 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000367048 MI0000466 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000367048 MI0000467 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000367048 MI0000468 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000367048 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000367048 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000367048 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000367048 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENST00000367048 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000367048 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENST00000367048 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000367048 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000367048 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENST00000367048 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACAT2 mRNA
17562736
alpha-hexachlorocyclohexane
  • alpha-hexachlorocyclohexane results in increased expression of ACAT2 mRNA
17785943
Dietary Fats
  • Dietary Fats results in decreased expression of ACAT2 mRNA
18042831
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ACAT2 mRNA
17555576
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ACAT2 mRNA
17351261
Hydralazine
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACAT2 mRNA
17183730
palm oil
  • palm oil results in decreased expression of ACAT2 mRNA
18042831
pirinixic acid
  • pirinixic acid results in decreased expression of ACAT2 mRNA
17426115
Progesterone
  • Progesterone results in increased expression of ACAT2 mRNA
18070364
Tamoxifen
  • Tamoxifen affects the expression of ACAT2 mRNA
17555576
Tetracycline
  • Tetracycline results in increased expression of ACAT2 mRNA
16917069
Uranium
  • Uranium affects the expression of ACAT2 mRNA
15672453
uranyl acetate
  • uranyl acetate affects the expression of ACAT2 mRNA
15672453
Valproic Acid
  • [Hydralazine co-treated with Valproic Acid] results in increased expression of ACAT2 mRNA
17183730

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Mental Retardation marker
Dystonia inferred via Valproic Acid 1851702
Fatty Liver inferred via Valproic Acid 14986274
Leukemia, Myeloid, Acute inferred via Valproic Acid 16294345
Migraine Disorders inferred via Valproic Acid 18765137, 18803445
Pseudolymphoma inferred via Valproic Acid 12752131
Seizures inferred via Valproic Acid 11738929
Unverricht-Lundborg Syndrome inferred via Valproic Acid 3119515
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 17242785, 15668708, 17049068, 17893378, 17440819, 17261762, 16873071, 16818667, 11161223
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hypertension, Pregnancy-Induced inferred via Hydralazine 16612254
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 16919318, 16105132, 11677210, 15861022, 17333356
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 14986274, 15968718, 16227642, 16177239, 17562736, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  2. [ + ] Jiang ZY, et al. (2009) "Increased NPC1L1 and ACAT2 expression in the jejunal mucosa from Chinese gallstone patients." Biochem Biophys Res Commun. 379(1):49-54. PMID:19071091
  3. [ + ] Yoshida T, et al. (2009) "Association of candidate gene polymorphisms with chronic kidney disease in Japanese individuals with hypertension." Hypertens Res. 32(5):411-418. PMID:19282863
  4. [ + ] Matsumoto K, et al. (2008) "Expression of two isozymes of acyl-coenzyme A: cholesterol acyltransferase-1 and -2 in clear cell type renal cell carcinoma." Int J Urol. 15(2):166-170. PMID:18269457
  5. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  6. [ + ] Locke JA, et al. (2008) "Androgen-mediated cholesterol metabolism in LNCaP and PC-3 cell lines is regulated through two different isoforms of acyl-coenzyme A:Cholesterol Acyltransferase (ACAT)." Prostate. 68(1):20-33. PMID:18000807
  7. [ + ] Pramfalk C, et al. (2007) "Cholesterol regulates ACAT2 gene expression and enzyme activity in human hepatoma cells." Biochem Biophys Res Commun. 364(2):402-409. PMID:17950700
  8. [ + ] Yamada Y, et al. (2007) "Prediction of genetic risk for dyslipidemia." Genomics. 90(5):551-558. PMID:17919884
  9. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  10. [ + ] He X, et al. (2005) "Acyl-CoA: cholesterol acyltransferase-2 gene polymorphisms and their association with plasma lipids and coronary artery disease risks." Hum Genet. 118(3-4):393-403. PMID:16195894
  11. [ + ] Kursula P, et al. (2005) "High resolution crystal structures of human cytosolic thiolase (CT): a comparison of the active sites of human CT, bacterial thiolase, and bacterial KAS I." J Mol Biol. 347(1):189-201. PMID:15733928
  12. [ + ] Suzuki Y, et al. (2004) "Sequence comparison of human and mouse genes reveals a homologous block structure in the promoter regions." Genome Res. 14(9):1711-1718. PMID:15342556
  13. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  14. [ + ] Ohta T, et al. (2004) "The influence of the acyl-CoA:cholesterol acyltransferase-1 gene (-77G-->A) polymorphisms on plasma lipid and apolipoprotein levels in normolipidemic and hyperlipidemic subjects." Biochim Biophys Acta. 1682(1-3):56-62. PMID:15158756
  15. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  16. [ + ] Katsuren K, et al. (2003) "Effects of a new single-nucleotide polymorphism in the Acyl-CoA:cholesterol acyltransferase-2 gene on plasma lipids and apolipoproteins in patients with hyperlipidemia." J Atheroscler Thromb. 10(1):32-36. PMID:12621162
  17. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  18. [ + ] McCarthy JJ, et al. (2003) "Evidence for substantial effect modification by gender in a large-scale genetic association study of the metabolic syndrome among coronary heart disease patients." Hum Genet. 114(1):87-98. PMID:14557872
  19. [ + ] Song BL, et al. (2003) "Preparation of an anti-Cdx-2 antibody for analysis of different species Cdx-2 binding to acat2 promoter." Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai). 35(1):6-12. PMID:12518221
  20. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  21. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  22. [ + ] Masuno M, et al. (1996) "Assignment of the human cytosolic acetoacetyl-coenzyme A thiolase (ACAT2) gene to chromosome 6q25.3-q26." Genomics. 36(1):217-218. PMID:8812443
  23. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  24. [ + ] Song XQ, et al. (1994) "Molecular cloning and nucleotide sequence of complementary DNA for human hepatic cytosolic acetoacetyl-coenzyme A thiolase." Biochem Biophys Res Commun. 201(1):478-485. PMID:7911016
  25. [ + ] Morel Y, et al. (1989) "Transcript encoded on the opposite strand of the human steroid 21-hydroxylase/complement component C4 gene locus." Proc Natl Acad Sci U S A. 86(17):6582-6586. PMID:2475872
  26. [ + ] Bennett MJ, et al. (1984) "Biochemical investigations on a patient with a defect in cytosolic acetoacetyl-CoA thiolase, associated with mental retardation." J Inherit Metab Dis. 7(3):125-128. PMID:6150136