acbp-7 | GeneID:3896747 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 3896747 Official Symbol acbp-7
Locus F26A1.15 Gene Type protein-coding
Synonyms
Full Name N/A
Description Acyl-Coenzyme A Binding Protein
Chromosome N/A
Also Known As Acyl-Coenzyme A Binding Protein family member (acbp-7)
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0000062 Function acyl-CoA binding
GO:0005488 Function binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001038270 NP_001033359

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
F26A1.15 MI0000308 cel-miR-233 UUGAGCAAUGCGCAUGUGCGG
F26A1.15 MI0000755 cel-miR-356 UUGAGCAACGCGAACAAAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719