0610007C21Rik | GeneID:381629 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 381629 Official Symbol 0610007C21Rik
Locus N/A Gene Type protein-coding
Synonyms AI316792; Apr3; HSPC013; p18
Full Name RIKEN cDNA 0610007C21 gene
Description RIKEN cDNA 0610007C21 gene
Chromosome 5 B1
Also Known As H1E6 protein; OTTMUSP00000025430; OTTMUSP00000025431; apoptosis related protein APR-3
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15412

ID Symbol Protein Species
GeneID:51374 C2orf28 NP_542159.2 Homo sapiens
GeneID:298841 RGD1311605 XP_216650.3 Rattus norvegicus
GeneID:381629 0610007C21Rik NP_082131.2 Mus musculus
GeneID:475699 LOC475699 XP_532906.2 Canis lupus familiaris
GeneID:553468 si:ch211-101l18.3 XP_696734.2 Danio rerio
GeneID:740920 LOC740920 XP_001154610.1 Pan troglodytes

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_027855  UCSC Browser NP_082131 A8C1S6   Q6PGD0  
2 NM_212470  UCSC Browser NP_997635

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000013766 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENSMUST00000013766 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSMUST00000013766 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSMUST00000013766 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSMUST00000013766 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSMUST00000013766 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENSMUST00000013766 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSMUST00000013766 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENSMUST00000013766 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENSMUST00000013766 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENSMUST00000013766 MI0003627 hsa-miR-614 GAACGCCUGUUCUUGCCAGGUGG
ENSMUST00000013766 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENSMUST00000013766 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSMUST00000013766 MI0003642 hsa-miR-628-3p UCUAGUAAGAGUGGCAGUCGA
ENSMUST00000013766 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSMUST00000013766 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSMUST00000013766 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSMUST00000013766 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENSMUST00000013766 MI0005524 hsa-miR-891a UGCAACGAACCUGAGCCACUGA
ENSMUST00000013766 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSMUST00000013766 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSMUST00000013766 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSMUST00000013766 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENSMUST00000013766 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSMUST00000013766 MI0000150 mmu-miR-124* CGUGUUCACAGCGGACCUUGAU
ENSMUST00000013766 MI0000716 mmu-miR-124* CGUGUUCACAGCGGACCUUGAU
ENSMUST00000013766 MI0000717 mmu-miR-124* CGUGUUCACAGCGGACCUUGAU
ENSMUST00000013766 MI0000151 mmu-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENSMUST00000013766 MI0000151 mmu-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENSMUST00000013766 MI0000241 mmu-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSMUST00000013766 MI0000713 mmu-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENSMUST00000013766 MI0000241 mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSMUST00000013766 MI0000713 mmu-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSMUST00000013766 MI0000688 mmu-miR-19a* UAGUUUUGCAUAGUUGCACUAC
ENSMUST00000013766 MI0005552 mmu-miR-208b AUAAGACGAACAAAAGGUUUGU
ENSMUST00000013766 MI0000702 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000013766 MI0000741 mmu-miR-219 UGAUUGUCCAAACGCAAUUCU
ENSMUST00000013766 MI0000402 mmu-miR-302a* ACUUAAACGUGGUUGUACUUGC
ENSMUST00000013766 MI0000548 mmu-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENSMUST00000013766 MI0000597 mmu-miR-325* CCUAGUAGGUGCUCAGUAAGUGU
ENSMUST00000013766 MI0000817 mmu-miR-335-3p UUUUUCAUUAUUGCUCCUGACC
ENSMUST00000013766 MI0000632 mmu-miR-345-3p CCUGAACUAGGGGUCUGGAGAC
ENSMUST00000013766 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENSMUST00000013766 MI0003535 mmu-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSMUST00000013766 MI0004125 mmu-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSMUST00000013766 MI0000795 mmu-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSMUST00000013766 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSMUST00000013766 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENSMUST00000013766 MI0002405 mmu-miR-470* AACCAGUACCUUUCUGAGAAGA
ENSMUST00000013766 MI0003484 mmu-miR-483 AAGACGGGAGAAGAGAAGGGAG
ENSMUST00000013766 MI0003484 mmu-miR-483* UCACUCCUCCCCUCCCGUCUU
ENSMUST00000013766 MI0003493 mmu-miR-486 UCCUGUACUGAGCUGCCCCGAG
ENSMUST00000013766 MI0005520 mmu-miR-654-5p UGGUAAGCUGCAGAACAUGUGU
ENSMUST00000013766 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSMUST00000013766 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSMUST00000013766 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENSMUST00000013766 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENSMUST00000013766 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENSMUST00000013766 MI0004696 mmu-miR-712* UGCGAGUCACCCCCGGGUGUUG
ENSMUST00000013766 MI0005471 mmu-miR-871 UAUUCAGAUUAGUGCCAGUCAUG
ENSMUST00000013766 MI0000583 mmu-miR-96 UUUGGCACUAGCACAUUUUUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  2. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  9. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
  10. [ + ] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548