ACAT1 | GeneID:38 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 38 Official Symbol ACAT1
Locus N/A Gene Type protein-coding
Synonyms ACAT; MAT; T2; THIL
Full Name acetyl-Coenzyme A acetyltransferase 1
Description acetyl-Coenzyme A acetyltransferase 1
Chromosome 11q22.3-q23.1
Also Known As acetoacetyl Coenzyme A thiolase; mitochondrial acetoacetyl-CoA thiolase
Summary This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6

ID Symbol Protein Species
GeneID:38 ACAT1 NP_000010.1 Homo sapiens
GeneID:25014 Acat1 NP_058771.1 Rattus norvegicus
GeneID:31695 CG10932 NP_572414.1 Drosophila melanogaster
GeneID:110446 Acat1 NP_659033.1 Mus musculus
GeneID:174161 kat-1 NP_495455.2 Caenorhabditis elegans
GeneID:187992 T02G5.4 NP_495461.1 Caenorhabditis elegans
GeneID:418968 ACAT1 XP_417162.2 Gallus gallus
GeneID:445290 acat1 NP_001003746.1 Danio rerio
GeneID:451528 ACAT1 XP_508738.2 Pan troglodytes
GeneID:489421 ACAT1 XP_546539.2 Canis lupus familiaris
GeneID:511082 ACAT1 NP_001039540.1 Bos taurus
GeneID:834876 ACAT2/EMB1276 NP_568694.2 Arabidopsis thaliana
GeneID:856079 ERG10 NP_015297.1 Saccharomyces cerevisiae
GeneID:1270608 AgaP_AGAP011329 XP_309320.2 Anopheles gambiae
GeneID:2540616 erg10 NP_596686.1 Schizosaccharomyces pombe
GeneID:2713586 NCU02571.1 XP_331770.1 Neurospora crassa
GeneID:2893283 KLLA0D12056g XP_453599.1 Kluyveromyces lactis
GeneID:4346520 Os09g0252100 NP_001062685.1 Oryza sativa
GeneID:4620424 AGOS_ADR165C NP_984262.1 Eremothecium gossypii
GeneID:5051652 MGG_13499 XP_001415110.1 Magnaporthe grisea

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71407 ACAT1 antibody - C-terminal (ab71407); Rabbit polyclonal to ACAT1 - C-terminal
2 abgent AP7560b ACAT1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP14202PU-N ACAT1 / MAT (C-term); antibody Ab
4 acris AP08224PU-N ACAT1 / MAT (aa 6-23); antibody Ab
5 scbt ACAT1 ACAT1 Antibody / ACAT1 Antibodies;
6 sigma HPA004428 Anti-ACAT1 antibody produced in rabbit ;
7 sigma HPA007569 Anti-ACAT1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAT1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAT1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0003985 Function acetyl-CoA C-acetyltransferase activity
GO:0016407 Function acetyltransferase activity
GO:0046872 Function metal ion binding
GO:0030955 Function potassium ion binding
GO:0005515 Function protein binding
GO:0016740 Function transferase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000019  UCSC Browser NP_000010 P24752   B2R6H1  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000265838 MI0000064 hsa-let-7c* UAGAGUUACACCCUGGGAGUUA
ENST00000265838 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENST00000265838 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000265838 MI0000459 hsa-miR-143 UGAGAUGAAGCACUGUAGCUC
ENST00000265838 MI0000234 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
ENST00000265838 MI0000487 hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU
ENST00000265838 MI0003137 hsa-miR-193b AACUGGCCCUCAAAGUCCCGCU
ENST00000265838 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000265838 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000265838 MI0000077 hsa-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENST00000265838 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000265838 MI0000291 hsa-miR-215 AUGACCUAUGAAUUGACAGAC
ENST00000265838 MI0000301 hsa-miR-224 CAAGUCACUAGUGGUUCCGUU
ENST00000265838 MI0000085 hsa-miR-27a UUCACAGUGGCUAAGUUCCGC
ENST00000265838 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000265838 MI0000440 hsa-miR-27b UUCACAGUGGCUAAGUUCUGC
ENST00000265838 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000265838 MI0000773 hsa-miR-302c* UUUAACAUGGGGGUACCUGCUG
ENST00000265838 MI0000806 hsa-miR-337-5p GAACGGCUUCAUACAGGAGUU
ENST00000265838 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000265838 MI0000760 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU
ENST00000265838 MI0000777 hsa-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENST00000265838 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000265838 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000265838 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000265838 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000265838 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENST00000265838 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000265838 MI0000788 hsa-miR-380* UGGUUGACCAUAGAACAUGCGC
ENST00000265838 MI0001727 hsa-miR-453 AGGUUGUCCGUGGUGAGUUCGCA
ENST00000265838 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENST00000265838 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000265838 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000265838 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENST00000265838 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENST00000265838 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENST00000265838 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000265838 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000265838 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000265838 MI0000746 hsa-miR-99b CACCCGUAGAACCGACCUUGCG
ENST00000265838 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000265838 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000265838 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENST00000265838 MI0004698 mmu-miR-713 UGCACUGAAGGCACACAGC
ENST00000265838 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACAT1 mRNA
17562736
bexarotene
  • bexarotene results in increased expression of ACAT1 mRNA
16648578
Dietary Fats
  • Dietary Fats results in increased expression of ACAT1 mRNA
18042831
Dust
  • Dust results in decreased expression of ACAT1 mRNA
17805423
Nitroglycerin
  • Nitroglycerin results in increased expression of ACAT1 mRNA
12102619
palm oil
  • palm oil results in increased expression of ACAT1 mRNA
18042831
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACAT1 mRNA
16221955
Phosphatidylcholines
  • Phosphatidylcholines results in decreased activity of ACAT1 protein
12559476
pirinixic acid
  • pirinixic acid results in increased expression of ACAT1 mRNA
18301758
pirinixic acid
  • pirinixic acid results in increased expression of ACAT1 mRNA
16940010
Probucol
  • Probucol results in decreased activity of ACAT1 protein
16292755
Soybean Oil
  • Soybean Oil results in decreased activity of ACAT1 protein
12559476
Vitamin E
  • Vitamin E results in decreased activity of ACAT1 protein
16292755

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ALPHA-METHYLACETOACETIC ACIDURIA marker
Carbon Tetrachloride Poisoning inferred via Vitamin E 16050911
Heart Defects, Congenital inferred via Vitamin E 16080930
Hernia, Diaphragmatic inferred via Vitamin E 16863852, 16490937
Influenza, Human inferred via Vitamin E 16624496
Kidney Diseases inferred via Vitamin E 12488133
Liver Cirrhosis, Experimental inferred via Vitamin E 16169303
Lung Diseases inferred via Vitamin E 16863852
Lung Neoplasms inferred via Vitamin E 11062179
Prostatic Neoplasms inferred via Vitamin E 15084515
Stroke inferred via Vitamin E 16517955
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Liver Cirrhosis, Experimental inferred via Phosphatidylcholines 16169303
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Methemoglobinemia inferred via Nitroglycerin 3537620
Myocardial Infarction inferred via Nitroglycerin 14729435
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 16081117, 17562736, 15968718, 16227642, 16177239, 14986274
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
GC20 GC20 / ACAT1 Affinity Capture-MS Ewing RM (2007)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ruano G, et al. (2009) "Physiogenomic comparison of edema and BMI in patients receiving rosiglitazone or pioglitazone." Clin Chim Acta. 400(1-2):48-55. PMID:18996102
  2. [ + ] Xin C, et al. (2009) "Study of the insulin signaling pathways in the regulation of ACAT1 expression in cultured macrophages." Cell Biol Int. 33(5):602-606. PMID:19269342
  3. [ + ] Kanome T, et al. (2008) "Angiotensin II upregulates acyl-CoA:cholesterol acyltransferase-1 via the angiotensin II Type 1 receptor in human monocyte-macrophages." Hypertens Res. 31(9):1801-1810. PMID:18971559
  4. [ + ] An S, et al. (2008) "Inhibition of acyl-coenzyme A:cholesterol acyltransferase stimulates cholesterol efflux from macrophages and stimulates farnesoid X receptor in hepatocytes." Exp Mol Med. 40(4):407-417. PMID:18779653
  5. [ + ] Raman J, et al. (2008) "The catalytic and lectin domains of UDP-GalNAc:polypeptide alpha-N-Acetylgalactosaminyltransferase function in concert to direct glycosylation site selection." J Biol Chem. 283(34):22942-22951. PMID:18562306
  6. [ + ] Chen J, et al. (2008) "RNA secondary structures located in the interchromosomal region of human ACAT1 chimeric mRNA are required to produce the 56-kDa isoform." Cell Res. 18(9):921-936. PMID:18542101
  7. [ + ] Fukao T, et al. (2008) "A novel single-base substitution (c.1124A>G) that activates a 5-base upstream cryptic splice donor site within exon 11 in the human mitochondrial acetoacetyl-CoA thiolase gene." Mol Genet Metab. 94(4):417-421. PMID:18511318
  8. [ + ] Li Q, et al. (2008) "[Analysis of acyl-coenzyme A: cholesterol acyltransferase 1 polymorphism in patients with endogenous hypertriglyceridemia in Chinese population]" Zhonghua Yi Xue Yi Chuan Xue Za Zhi. 25(2):206-210. PMID:18393248
  9. [ + ] Locke JA, et al. (2008) "Androgen-mediated cholesterol metabolism in LNCaP and PC-3 cell lines is regulated through two different isoforms of acyl-coenzyme A:Cholesterol Acyltransferase (ACAT)." Prostate. 68(1):20-33. PMID:18000807
  10. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  11. [ + ] Bzoma B, et al. (2008) "[Genetic predisposition to systemic complications of arterial hypertension in maintenance haemodialysis patients]" Pol Merkur Lekarski. 25(147):209-216. PMID:19112833
  12. [ + ] Ewing RM, et al. (2007) "Large-scale mapping of human protein-protein interactions by mass spectrometry." Mol Syst Biol. 3():89. PMID:17353931
  13. [ + ] Guo ZY, et al. (2007) "Functionality of the seventh and eighth transmembrane domains of acyl-coenzyme A:cholesterol acyltransferase 1." Biochemistry. 46(35):10063-10071. PMID:17691824
  14. [ + ] Haapalainen AM, et al. (2007) "Crystallographic and kinetic studies of human mitochondrial acetoacetyl-CoA thiolase: the importance of potassium and chloride ions for its structure and function." Biochemistry. 46(14):4305-4321. PMID:17371050
  15. [ + ] Sakurai S, et al. (2007) "Kinetic and expression analyses of seven novel mutations in mitochondrial acetoacetyl-CoA thiolase (T2): identification of a Km mutant and an analysis of the mutational sites in the structure." Mol Genet Metab. 90(4):370-378. PMID:17236799
  16. [ + ] Zhang G, et al. (2006) "Identification of Alu-mediated, large deletion-spanning exons 2-4 in a patient with mitochondrial acetoacetyl-CoA thiolase deficiency." Mol Genet Metab. 89(3):222-226. PMID:16935016
  17. [ + ] Oh JH, et al. (2005) "Transcriptome analysis of human gastric cancer." Mamm Genome. 16(12):942-954. PMID:16341674
  18. [ + ] Zhang GX, et al. (2004) "Mitochondrial acetoacetyl-CoA thiolase (T2) deficiency: T2-deficient patients with "mild" mutation(s) were previously misinterpreted as normal by the coupled assay with tiglyl-CoA." Pediatr Res. 56(1):60-64. PMID:15128923
  19. [ + ] Ohta T, et al. (2004) "The influence of the acyl-CoA:cholesterol acyltransferase-1 gene (-77G-->A) polymorphisms on plasma lipid and apolipoprotein levels in normolipidemic and hyperlipidemic subjects." Biochim Biophys Acta. 1682(1-3):56-62. PMID:15158756
  20. [ + ] Aboulaich N, et al. (2004) "Vectorial proteomics reveal targeting, phosphorylation and specific fragmentation of polymerase I and transcript release factor (PTRF) at the surface of caveolae in human adipocytes." Biochem J. 383(Pt 2):237-248. PMID:15242332
  21. [ + ] Fukao T, et al. (2003) "Single base substitutions at the initiator codon in the mitochondrial acetoacetyl-CoA thiolase (ACAT1/T2) gene result in production of varying amounts of wild-type T2 polypeptide." Hum Mutat. 21(6):587-592. PMID:12754704
  22. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  23. [ + ] Fukao T, et al. (1998) "Characterization of N93S, I312T, and A333P missense mutations in two Japanese families with mitochondrial acetoacetyl-CoA thiolase deficiency." Hum Mutat. 12(4):245-254. PMID:9744475
  24. [ + ] Sewell AC, et al. (1998) "Mitochondrial acetoacetyl-CoA thiolase (beta-ketothiolase) deficiency and pregnancy." J Inherit Metab Dis. 21(4):441-442. PMID:9700610
  25. [ + ] Watanabe H, et al. (1998) "Practical assay method of cytosolic acetoacetyl-CoA thiolase by rapid release of cytosolic enzymes from cultured lymphocytes using digitonin." Tohoku J Exp Med. 184(1):29-38. PMID:9607396
  26. [ + ] Fukao T, et al. (1997) "Enzymes of ketone body utilization in human tissues: protein and messenger RNA levels of succinyl-coenzyme A (CoA):3-ketoacid CoA transferase and mitochondrial and cytosolic acetoacetyl-CoA thiolases." Pediatr Res. 42(4):498-502. PMID:9380443
  27. [ + ] Fukao T, et al. (1995) "Molecular basis of beta-ketothiolase deficiency: mutations and polymorphisms in the human mitochondrial acetoacetyl-coenzyme A thiolase gene." Hum Mutat. 5(2):113-120. PMID:7749408
  28. [ + ] Wakazono A, et al. (1995) "Molecular, biochemical, and clinical characterization of mitochondrial acetoacetyl-coenzyme A thiolase deficiency in two further patients." Hum Mutat. 5(1):34-42. PMID:7728148
  29. [ + ] Fukao T, et al. (1994) "Identification of a novel exonic mutation at -13 from 5' splice site causing exon skipping in a girl with mitochondrial acetoacetyl-coenzyme A thiolase deficiency." J Clin Invest. 93(3):1035-1041. PMID:7907600
  30. [ + ] Fukao T, et al. (1993) "Molecular studies of mitochondrial acetoacetyl-coenzyme A thiolase deficiency in the two original families." Hum Mutat. 2(3):214-220. PMID:8103405
  31. [ + ] Fukao T, et al. (1992) "Identification of three mutant alleles of the gene for mitochondrial acetoacetyl-coenzyme A thiolase. A complete analysis of two generations of a family with 3-ketothiolase deficiency." J Clin Invest. 89(2):474-479. PMID:1346617
  32. [ + ] Masuno M, et al. (1992) "Chromosome mapping of the human mitochondrial acetoacetyl-coenzyme A thiolase gene to 11q22.3----q23.1 by fluorescence in situ hybridization." Cytogenet Cell Genet. 60(2):121-122. PMID:1351831
  33. [ + ] Fukao T, et al. (1992) "Molecular basis of 3-ketothiolase deficiency: identification of an AG to AC substitution at the splice acceptor site of intron 10 causing exon 11 skipping." Biochim Biophys Acta. 1139(3):184-188. PMID:1627655
  34. [ + ] Fukao T, et al. (1991) "Evidence for a structural mutation (347Ala to Thr) in a German family with 3-ketothiolase deficiency." Biochem Biophys Res Commun. 179(1):124-129. PMID:1715688
  35. [ + ] Kano M, et al. (1991) "Structure and expression of the human mitochondrial acetoacetyl-CoA thiolase-encoding gene." Gene. 109(2):285-290. PMID:1684944
  36. [ + ] Fukao T, et al. (1990) "Molecular cloning and sequence of the complementary DNA encoding human mitochondrial acetoacetyl-coenzyme A thiolase and study of the variant enzymes in cultured fibroblasts from patients with 3-ketothiolase deficiency." J Clin Invest. 86(6):2086-2092. PMID:1979337
  37. [ + ] Middleton B, et al. (1986) "3-Ketothiolase deficiency." Eur J Pediatr. 144(6):586-589. PMID:3709573
  38. [ + ] Schutgens RB, et al. (1982) "Beta-ketothiolase deficiency in a family confirmed by in vitro enzymatic assays in fibroblasts." Eur J Pediatr. 139(1):39-42. PMID:7173255
  39. [ + ] Daum RS, et al. (1973) "An inherited disorder of isoleucine catabolism causing accumulation of alpha-methylacetoacetate and alpha-methyl-beta -hydroxybutyrate, and intermittent metabolic acidosis." Pediatr Res. 7(3):149-160. PMID:4690360