abat | GeneID:378968 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 378968 Official Symbol abat
Locus N/A Gene Type protein-coding
Synonyms cb880; fj82a01; wu:fj82a01
Full Name 4-aminobutyrate aminotransferase
Description 4-aminobutyrate aminotransferase
Chromosome N/A
Also Known As GABA-T
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 542

ID Symbol Protein Species
GeneID:18 ABAT NP_000654.2 Homo sapiens
GeneID:40188 CG7433 NP_649168.2 Drosophila melanogaster
GeneID:81632 Abat NP_112265.1 Rattus norvegicus
GeneID:177897 gta-1 NP_501862.1 Caenorhabditis elegans
GeneID:268860 Abat NP_766549.2 Mus musculus
GeneID:378968 abat NP_958906.1 Danio rerio
GeneID:416642 ABAT XP_414940.2 Gallus gallus
GeneID:453903 ABAT XP_001137090.1 Pan troglodytes
GeneID:479856 ABAT XP_851424.1 Canis lupus familiaris
GeneID:506219 ABAT XP_582638.2 Bos taurus
GeneID:852902 UGA1 NP_011533.1 Saccharomyces cerevisiae
GeneID:1270119 AgaP_AGAP006966 XP_308791.2 Anopheles gambiae
GeneID:2542494 SPAC19D5.07 NP_594905.1 Schizosaccharomyces pombe
GeneID:2679339 MGG_01662 XP_363736.1 Magnaporthe grisea
GeneID:2713300 NCU08998.1 XP_331390.1 Neurospora crassa
GeneID:2895485 KLLA0F20548g XP_456003.1 Kluyveromyces lactis
GeneID:4622915 AGOS_AGL050C NP_986616.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003867 Function 4-aminobutyrate transaminase activity
GO:0003824 Function catalytic activity
GO:0030170 Function pyridoxal phosphate binding
GO:0008483 Function transaminase activity
GO:0016740 Function transferase activity
GO:0009448 Process gamma-aminobutyric acid metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_201498 NP_958906

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000027468 MI0002007 dre-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSDART00000027468 MI0002008 dre-miR-143 UGAGAUGAAGCACUGUAGCUC
ENSDART00000027468 MI0002015 dre-miR-148 UCAGUGCAUUACAGAACUUUGU
ENSDART00000027468 MI0001897 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000027468 MI0001898 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000027468 MI0002026 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000027468 MI0003243 dre-miR-184 UGGACGGAGAACUGAUAAGGGC
ENSDART00000027468 MI0003256 dre-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSDART00000027468 MI0004778 dre-miR-733 UGCGUUGGUUUAGCUCAGUGGUU
ENSDART00000027468 MI0001361 dre-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSDART00000027468 MI0001362 dre-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSDART00000027468 MI0001879 dre-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSDART00000027468 MI0001360 dre-miR-7b UGGAAGACUUGUGAUUUUGUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Martyniuk CJ, et al. (2007) "Glutamic acid decarboxylase 65, 67, and GABA-transaminase mRNA expression and total enzyme activity in the goldfish (Carassius auratus) brain." Brain Res. 1147():154-166. PMID:17362888
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932