aaas | GeneID:378454 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 378454 Official Symbol aaas
Locus N/A Gene Type protein-coding
Synonyms zgc:85873
Full Name achalasia, adrenocortical insufficiency, alacrimia
Description achalasia, adrenocortical insufficiency, alacrimia
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9232

ID Symbol Protein Species
GeneID:8086 AAAS NP_056480.1 Homo sapiens
GeneID:31881 CG16892 NP_572557.1 Drosophila melanogaster
GeneID:223921 Aaas NP_700465.1 Mus musculus
GeneID:378454 aaas NP_998390.1 Danio rerio
GeneID:467003 AAAS XP_522403.2 Pan troglodytes
GeneID:506561 AAAS NP_001068737.1 Bos taurus
GeneID:607867 AAAS XP_849797.1 Canis lupus familiaris
GeneID:824857 AT3G56900 NP_191249.2 Arabidopsis thaliana
GeneID:1272488 AgaP_AGAP010685 XP_311401.2 Anopheles gambiae
GeneID:4349688 Os11g0132700 NP_001065665.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_213225 NP_998390

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000004735 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000004735 MI0001987 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000004735 MI0001988 dre-miR-130c CAGUGCAAUAUUAAAAGGGCAU
ENSDART00000004735 MI0002048 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000004735 MI0002049 dre-miR-216b UAAUCUCUGCAGGCAACUGUGA
ENSDART00000004735 MI0002177 dre-miR-457a AAGCAGCACAUCAAUAUUGGCA
ENSDART00000004735 MI0002181 dre-miR-460-3p CACAGCGCAUACAAUGUGGAUG
ENSDART00000004735 MI0004784 dre-miR-738 GCUACGGCCCGCGUCGGGACCUC
ENSDART00000004735 MI0004881 xtr-miR-383 AGAUCAGAAGGUGAUUGUGGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932