KCNH2 | GeneID:3757 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 3757 | Official Symbol | KCNH2 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ERG1; HERG; HERG1; Kv11.1; LQT2; SQT1 | ||
| Full Name | potassium voltage-gated channel, subfamily H (eag-related), member 2 | ||
| Description | potassium voltage-gated channel, subfamily H (eag-related), member 2 | ||
| Chromosome | 7q35-q36 | ||
| Also Known As | ether-a-go-go-related potassium channel protein; voltage-gated potassium channel, subfamily H, member 2 | ||
| Summary | This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 201
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:3757 | KCNH2 | NP_000229.1 | Homo sapiens |
| GeneID:16511 | Kcnh2 | NP_038597.1 | Mus musculus |
| GeneID:117018 | Kcnh2 | NP_446401.1 | Rattus norvegicus |
| GeneID:403761 | KCNH2 | NP_001003145.1 | Canis lupus familiaris |
| GeneID:463894 | KCNH2 | XP_001137384.1 | Pan troglodytes |
| GeneID:539971 | KCNH2 | XP_590603.3 | Bos taurus |
| GeneID:100150957 | LOC100150957 | XP_001918581.1 | Danio rerio |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab53593 | KCNH2 antibody - Carboxyterminal end (ab53593); Rabbit polyclonal to KCNH2 - Carboxyterminal end |
| 2 | abcam | ab53590 | KCNH2 antibody (ab53590); Rabbit polyclonal to KCNH2 |
| 3 | acris | AP18083PU-N | KCNH2 (Center); antibody Ab |
| 4 | scbt | KCNH2 | KCNH2 Antibody / KCNH2 Antibodies; |
| 5 | sigma | P0749 | Anti-Potassium Channel Kv11.1 Extracellular antibody produced in rabbit ; |
| 6 | sigma | P9497 | Anti-Potassium Channel hKv11.1 antibody produced in rabbit ; |
| 7 | sigma | K0640 | Anti-Potassium Channel Kv11.1 (HERG) Extracellular−FITC antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0008076 | Component | voltage-gated potassium channel complex |
| GO:0005251 | Function | delayed rectifier potassium channel activity |
| GO:0030955 | Function | potassium ion binding |
| GO:0000155 | Function | two-component sensor activity |
| GO:0005244 | Function | voltage-gated ion channel activity |
| GO:0008015 | Process | blood circulation |
| GO:0006811 | Process | ion transport |
| GO:0006936 | Process | muscle contraction |
| GO:0006813 | Process | potassium ion transport |
| GO:0008016 | Process | regulation of heart contraction |
| GO:0006355 | Process | regulation of transcription, DNA-dependent |
| GO:0007605 | Process | sensory perception of sound |
| GO:0000160 | Process | two-component signal transduction system (phosphorelay) |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000262186 | MI0000443 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000262186 | MI0000444 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000262186 | MI0000445 | hsa-miR-124* | CGUGUUCACAGCGGACCUUGAU |
| ENST00000262186 | MI0000471 | hsa-miR-126* | CAUUAUUACUUUUGGUACGCG |
| ENST00000262186 | MI0000252 | hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGC |
| ENST00000262186 | MI0000473 | hsa-miR-129-5p | CUUUUUGCGGUCUGGGCUUGC |
| ENST00000262186 | MI0000456 | hsa-miR-140-3p | UACCACAGGGUAGAACCACGG |
| ENST00000262186 | MI0000681 | hsa-miR-155 | UUAAUGCUAAUCGUGAUAGGGGU |
| ENST00000262186 | MI0000732 | hsa-miR-194* | CCAGUGGGGCUGCUGUUAUCUG |
| ENST00000262186 | MI0000747 | hsa-miR-296-3p | GAGGGUUGGGUGGAGGCUCUCC |
| ENST00000262186 | MI0000747 | hsa-miR-296-5p | AGGGCCCCCCCUCAAUCCUGU |
| ENST00000262186 | MI0000772 | hsa-miR-302b* | ACUUUAACAUGGAAGUGCUUUC |
| ENST00000262186 | MI0000774 | hsa-miR-302d* | ACUUUAACAUGGAGGCACUUGC |
| ENST00000262186 | MI0000807 | hsa-miR-323-5p | AGGUGGUCCGUGGCGCGUUCGC |
| ENST00000262186 | MI0000813 | hsa-miR-324-3p | ACUGCCCCAGGUGCUGCUGG |
| ENST00000262186 | MI0000808 | hsa-miR-326 | CCUCUGGGCCCUUCCUCCAG |
| ENST00000262186 | MI0000804 | hsa-miR-328 | CUGGCCCUCUCUGCCCUUCCGU |
| ENST00000262186 | MI0000815 | hsa-miR-339-3p | UGAGCGCCUCGACGACAGAGCCG |
| ENST00000262186 | MI0000815 | hsa-miR-339-5p | UCCCUGUCCUCCAGGAGCUCACG |
| ENST00000262186 | MI0000742 | hsa-miR-34b* | UAGGCAGUGUCAUUAGCUGAUUG |
| ENST00000262186 | MI0000762 | hsa-miR-362-5p | AAUCCUUGGAACCUAGGUGUGAGU |
| ENST00000262186 | MI0000767 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENST00000262186 | MI0000769 | hsa-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENST00000262186 | MI0001648 | hsa-miR-449a | UGGCAGUGUAUUGUUAGCUGGU |
| ENST00000262186 | MI0003673 | hsa-miR-449b | AGGCAGUGUAUUGUUAGCUGGC |
| ENST00000262186 | MI0002468 | hsa-miR-484 | UCAGGCUCAGUCCCCUCCCGAU |
| ENST00000262186 | MI0003188 | hsa-miR-503 | UAGCAGCGGGAACAGUUCUGCAG |
| ENST00000262186 | MI0003190 | hsa-miR-505 | CGUCAACACUUGCUGGUUUCCU |
| ENST00000262186 | MI0005717 | hsa-miR-509-3-5p | UACUGCAGACGUGGCAAUCAUG |
| ENST00000262186 | MI0003144 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENST00000262186 | MI0003147 | hsa-miR-515-3p | GAGUGCCUUCUUUUGGAGCGUU |
| ENST00000262186 | MI0003205 | hsa-miR-532-5p | CAUGCCUUGAGUGUAGGACCGU |
| ENST00000262186 | MI0005539 | hsa-miR-541 | UGGUGGGCACAGAAUCUGGACU |
| ENST00000262186 | MI0003516 | hsa-miR-545* | UCAGUAAAUGUUUAUUAGAUGA |
| ENST00000262186 | MI0003600 | hsa-miR-550 | AGUGCCUGAGGGAGUAAGAGCCC |
| ENST00000262186 | MI0003601 | hsa-miR-550 | AGUGCCUGAGGGAGUAAGAGCCC |
| ENST00000262186 | MI0003572 | hsa-miR-566 | GGGCGCCUGUGAUCCCAAC |
| ENST00000262186 | MI0003576 | hsa-miR-569 | AGUUAAUGAAUCCUGGAAAGU |
| ENST00000262186 | MI0003603 | hsa-miR-591 | AGACCAUGGGUUCUCAUUGU |
| ENST00000262186 | MI0003610 | hsa-miR-598 | UACGUCAUCGUUGUCAUCGUCA |
| ENST00000262186 | MI0003614 | hsa-miR-601 | UGGUCUAGGAUUGUUGGAGGAG |
| ENST00000262186 | MI0003615 | hsa-miR-602 | GACACGGGCGACAGCUGCGGCCC |
| ENST00000262186 | MI0003625 | hsa-miR-612 | GCUGGGCAGGGCUUCUGAGCUCCUU |
| ENST00000262186 | MI0003666 | hsa-miR-651 | UUUAGGAUAAGCUUGACUUUUG |
| ENST00000262186 | MI0003669 | hsa-miR-661 | UGCCUGGGUCUCUGGCCUGCGCGU |
| ENST00000262186 | MI0005543 | hsa-miR-708 | AAGGAGCUUACAAUCUAGCUGGG |
| ENST00000262186 | MI0005527 | hsa-miR-886-3p | CGCGGGUGCUUACUGACCCUU |
| ENST00000262186 | MI0005712 | hsa-miR-920 | GGGGAGCUGUGGAAGCAGUA |
| ENST00000262186 | MI0005758 | hsa-miR-936 | ACAGUAGAGGGAGGAAUCGCAG |
| ENST00000262186 | MI0005769 | hsa-miR-944 | AAAUUAUUGUACAUCGGAUGAG |
| ENST00000262186 | MI0005493 | mmu-miR-327 | ACUUGAGGGGCAUGAGGAU |
| ENST00000262186 | MI0005494 | mmu-miR-343 | UCUCCCUUCAUGUGCCCAGA |
| ENST00000262186 | MI0002400 | mmu-miR-465a-3p | GAUCAGGGCCUUUCUAAGUAGA |
| ENST00000262186 | MI0004523 | mmu-miR-669a | AGUUGUGUGUGCAUGUUCAUGU |
| ENST00000262186 | MI0004667 | mmu-miR-669a | AGUUGUGUGUGCAUGUUCAUGU |
| ENST00000262186 | MI0004668 | mmu-miR-669a | AGUUGUGUGUGCAUGUUCAUGU |
| ENST00000262186 | MI0004601 | mmu-miR-673-3p | UCCGGGGCUGAGUUCUGUGCACC |
| ENST00000262186 | MI0004646 | mmu-miR-683 | CCUGCUGUAAGCUGUGUCCUC |
| ENST00000262186 | MI0004653 | mmu-miR-688 | UCGCAGGCGACUACUUAUUC |
| ENST00000262186 | MI0004683 | mmu-miR-699 | AGGCAGUGCGACCUGGCUCG |
| ENST00000262186 | MI0004678 | mmu-miR-720 | AUCUCGCUGGGGCCUCCA |
| ENST00000262186 | MI0004215 | mmu-miR-762 | GGGGCUGGGGCCGGGACAGAGC |
| ENST00000262186 | MI0000635 | rno-miR-347 | UGUCCCUCUGGGUCGCCCA |
| ENST00000262186 | MI0000636 | rno-miR-349 | CAGCCCUGCUGUCUUAACCUCU |
| ENST00000262186 | MI0000644 | rno-miR-352 | AGAGUAGUAGGUUGCAUAGUA |
Protein Sequences
[
] Protein Accession Number Cloud [ GenPept ]
AAA62473 AAC69709 AAH01914 AAH04311 AAI27674 AAI67862 AAL37559 AAP36000 AAQ91589 AAQ91590 AAQ91591 AAQ91592 AAQ91593 AAQ91594 AAQ91595 AAQ91596 AAQ91597 AAQ91598 AAQ91599 AAQ91600 AAQ91601 AAS07566 AAS07567 AAZ40507 AAZ40508 ABF71886 ACR24650 BAA37096 BAB19682 CAA09232 CAD54447 CAE82156 CAJ13411 CAJ13412 CAJ18800 CAJ18801 EAL24491 EAL24492 EAL24493 EAW54071 EAW54072 EAW54073 EAW54074 EAW54075 NP_000229 NP_742053 NP_742054 Q12809 Q15BH2 Q45QN4 Q45QN5 Q6U279 Q6U283 Q6U287 Q708S9 Q75MK8 Q75MK9 Q86U57
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Amsacrine | |
|
|
| Arsenic | |
|
|
| arsenic trioxide | |
|
|
| arsenic trioxide | |
|
|
| Carmustine | |
|
|
| Doxorubicin | |
|
|
| Erythromycin | |
|
|
| Ethinyl Estradiol | |
|
|
| Ethinyl Estradiol | |
|
|
| Flavonoids | |
|
|
| gabapentin | |
|
|
| ginsenoside Rb1 | |
|
|
| ginsenoside Re | |
|
|
| ginsenoside Rf | |
|
|
| ginsenoside Rg1 | |
|
|
| lamotrigine | |
|
|
| Mercury | |
|
|
| panaxadiol | |
|
|
| panaxatriol | |
|
|
| Pentamidine | |
|
|
| Saponins | |
|
|
| Tamoxifen | |
|
|
| topiramate | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Gene Interactions
[
] BioGRID Gene Product Interaction Database
| Symbol | Interaction Binary | Experiment | Source |
|---|---|---|---|
| HRPT2 | KCNH2 / HRPT2 | Two-hybrid | Stelzl U (2005) |
| KCNE1 | KCNE1 / KCNH2 | Invitro | McDonald TV (1997) |
| KCR1 | KCR1 / KCNH2 | Affinity Capture-Western | Kupershmidt S (2003) |
| NDUFS6 | KCNH2 / NDUFS6 | Two-hybrid | Stelzl U (2005) |
| YWHAE | KCNH2 / YWHAE | Affinity Capture-Western | Kagan A (2002) |
| YWHAE | YWHAE / KCNH2 | Reconstituted Complex | Kagan A (2002) |
| YWHAE | YWHAE / KCNH2 | Two-hybrid | Kagan A (2002) |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Chen J, et al. (2009) "PKA phosphorylation of HERG protein regulates the rate of channel synthesis." Am J Physiol Heart Circ Physiol. 296(5):H1244-H1254. PMID:19234087 - [
] Newton-Cheh C, et al. (2009) "Common variants at ten loci influence QT interval duration in the QTGEN Study." Nat Genet. 41(4):399-406. PMID:19305408 - [
] Millat G, et al. (2009) "Contribution of long-QT syndrome genetic variants in sudden infant death syndrome." Pediatr Cardiol. 30(4):502-509. PMID:19322600 - [
] Lehtinen AB, et al. (2009) "Relationship between genetic variants in myocardial sodium and potassium channel genes and QT interval duration in diabetics: the Diabetes Heart Study." Ann Noninvasive Electrocardiol. 14(1):72-79. PMID:19149796 - [
] Al-Owais M, et al. (2009) "Role of intracellular domains in the function of the herg potassium channel." Eur Biophys J. 38(5):569-576. PMID:19172259 - [
] Pfeufer A, et al. (2009) "Common variants at ten loci modulate the QT interval duration in the QTSCD Study." Nat Genet. 41(4):407-414. PMID:19305409 - [
] Huffaker SJ, et al. (2009) "A primate-specific, brain isoform of KCNH2 affects cortical physiology, cognition, neuronal repolarization and risk of schizophrenia." Nat Med. 15(5):509-518. PMID:19412172 - [
] Marjamaa A, et al. (2009) "High prevalence of four long QT syndrome founder mutations in the Finnish population." Ann Med. 41(3):234-240. PMID:19160088 - [
] Delisle BP, et al. (2009) "Small GTPase determinants for the Golgi processing and plasmalemmal expression of human ether-a-go-go related (hERG) K+ channels." J Biol Chem. 284(5):2844-2853. PMID:19029296 - [
] Ganapathi SB, et al. (2009) "State-dependent block of HERG potassium channels by R-roscovitine: implications for cancer therapy." Am J Physiol Cell Physiol. 296(4):C701-C710. PMID:19244476 - [
] Marjamaa A, et al. (2009) "Common candidate gene variants are associated with QT interval duration in the general population." J Intern Med. 265(4):448-458. PMID:19019189 - [
] Nagaoka I, et al. (2008) "Mutation site dependent variability of cardiac events in Japanese LQT2 form of congenital long-QT syndrome." Circ J. 72(5):694-699. PMID:18441445 - [
] Larsen AP, et al. (2008) "Characterization of hERG1a and hERG1b potassium channels-a possible role for hERG1b in the I (Kr) current." Pflugers Arch. 456(6):1137-1148. PMID:18504605 - [
] Inanobe A, et al. (2008) "In silico prediction of the chemical block of human ether-a-go-go-related gene (hERG) K+ current." J Physiol Sci. 58(7):459-470. PMID:19032804 - [
] Kamiya K, et al. (2008) "Molecular determinants of hERG channel block by terfenadine and cisapride." J Pharmacol Sci. 108(3):301-307. PMID:18987434 - [
] Zhang X, et al. (2008) "Protective effect of KCNH2 single nucleotide polymorphism K897T in LQTS families and identification of novel KCNQ1 and KCNH2 mutations." BMC Med Genet. 9():87. PMID:18808722 - [
] Lin J, et al. (2008) "The regulation of the cardiac potassium channel (HERG) by caveolin-1." Biochem Cell Biol. 86(5):405-415. PMID:18923542 - [
] Deisemann H, et al. (2008) "Effects of common antitussive drugs on the hERG potassium channel current." J Cardiovasc Pharmacol. 52(6):494-499. PMID:19034038 - [
] Berge KE, et al. (2008) "Molecular genetic analysis of long QT syndrome in Norway indicating a high prevalence of heterozygous mutation carriers." Scand J Clin Lab Invest. 68(5):362-368. PMID:18752142 - [
] Bhuiyan ZA, et al. (2008) "Recurrent intrauterine fetal loss due to near absence of HERG: clinical and functional characterization of a homozygous nonsense HERG Q1070X mutation." Heart Rhythm. 5(4):553-561. PMID:18362022 - [
] Eddy CA, et al. (2008) "Identification of large gene deletions and duplications in KCNQ1 and KCNH2 in patients with long QT syndrome." Heart Rhythm. 5(9):1275-1281. PMID:18774102 - [
] Amin AS, et al. (2008) "Fever-induced QTc prolongation and ventricular arrhythmias in individuals with type 2 congenital long QT syndrome." J Clin Invest. 118(7):2552-2561. PMID:18551196 - [
] Lin MT, et al. (2008) "In utero onset of long QT syndrome with atrioventricular block and spontaneous or lidocaine-induced ventricular tachycardia: compound effects of hERG pore region mutation and SCN5A N-terminus variant." Heart Rhythm. 5(11):1567-1574. PMID:18848812 - [
] Teng GQ, et al. (2008) "Homozygous missense N629D hERG (KCNH2) potassium channel mutation causes developmental defects in the right ventricle and its outflow tract and embryonic lethality." Circ Res. 103(12):1483-1491. PMID:18948620 - [
] Christe G, et al. (2008) "A new C-terminal hERG mutation A915fs+47X associated with symptomatic LQT2 and auditory-trigger syncope." Heart Rhythm. 5(11):1577-1586. PMID:18984536 - [
] Zhang Y, et al. (2008) "Single nucleotide polymorphisms and haplotype of four genes encoding cardiac ion channels in Chinese and their association with arrhythmia." Ann Noninvasive Electrocardiol. 13(2):180-190. PMID:18426444 - [
] Koskela J, et al. (2008) "Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study." Scand J Clin Lab Invest. 68(1):31-38. PMID:17852802 - [
] Biliczki P, et al. (2008) "Cellular properties of C-terminal KCNH2 long QT syndrome mutations: description and divergence from clinical phenotypes." Heart Rhythm. 5(8):1159-1167. PMID:18675227 - [
] Perrin MJ, et al. (2008) "Human ether-a-go-go related gene (hERG) K+ channels: function and dysfunction." Prog Biophys Mol Biol. 98(2-3):137-148. PMID:19027781 - [
] Miranda P, et al. (2008) "FRET with multiply labeled HERG K(+) channels as a reporter of the in vivo coarse architecture of the cytoplasmic domains." Biochim Biophys Acta. 1783(10):1681-1699. PMID:18634834 - [
] Lin J, et al. (2008) "The four and a half LIM domain protein 2 interacts with and regulates the HERG channel." FEBS J. 275(18):4531-4539. PMID:18680509 - [
] Sale H, et al. (2008) "Physiological properties of hERG 1a/1b heteromeric currents and a hERG 1b-specific mutation associated with Long-QT syndrome." Circ Res. 103(7):e81-e95. PMID:18776039 - [
] Otagiri T, et al. (2008) "Cardiac ion channel gene mutations in sudden infant death syndrome." Pediatr Res. 64(5):482-487. PMID:18596570 - [
] Wu ZY, et al. (2008) "Stimulation of N-terminal truncated isoform of androgen receptor stabilizes human ether-a-go-go-related gene-encoded potassium channel protein via activation of extracellular signal regulated kinase 1/2." Endocrinology. 149(10):5061-5069. PMID:18599551 - [
] Zhao J, et al. (2008) "Silencing of herg gene by shRNA inhibits SH-SY5Y cell growth in vitro and in vivo." Eur J Pharmacol. 579(1-3):50-57. PMID:17976575 - [
] Gordon E, et al. (2008) "2-[2-(3,4-dichloro-phenyl)-2,3-dihydro-1H-isoindol-5-ylamino]-nicotinic acid (PD-307243) causes instantaneous current through human ether-a-go-go-related gene potassium channels." Mol Pharmacol. 73(3):639-651. PMID:18042732 - [
] Phartiyal P, et al. (2008) "Endoplasmic reticulum retention and rescue by heteromeric assembly regulate human ERG 1a/1b surface channel composition." J Biol Chem. 283(7):3702-3707. PMID:18048364 - [
] Sinner MF, et al. (2008) "The non-synonymous coding IKr-channel variant KCNH2-K897T is associated with atrial fibrillation: results from a systematic candidate gene-based analysis of KCNH2 (HERG)." Eur Heart J. 29(7):907-914. PMID:18222980 - [
] Huo J, et al. (2008) "The G604S-hERG mutation alters the biophysical properties and exerts a dominant-negative effect on expression of hERG channels in HEK293 cells." Pflugers Arch. 456(5):917-928. PMID:18386051 - [
] Piper DR, et al. (2008) "Cooperative interactions between R531 and acidic residues in the voltage sensing module of hERG1 channels." Cell Physiol Biochem. 21(1-3):37-46. PMID:18209470 - [
] Luo X, et al. (2008) "Genomic structure, transcriptional control, and tissue distribution of HERG1 and KCNQ1 genes." Am J Physiol Heart Circ Physiol. 294(3):H1371-H1380. PMID:18192214 - [
] Black LA, et al. (2008) "Minimization of potential hERG liability in histamine H3 receptor antagonists." Inflamm Res. 57 Suppl 1():S45-S46. PMID:18345496 - [
] Gong Q, et al. (2008) "A splice site mutation in hERG leads to cryptic splicing in human long QT syndrome." J Mol Cell Cardiol. 44(3):502-509. PMID:18272172 - [
] Luo T, et al. (2008) "Inhibition of the HERG channel by droperidol depends on channel gating and involves the S6 residue F656." Anesth Analg. 106(4):1161-70, table of contents. PMID:18349188 - [
] Park SJ, et al. (2008) "Blockade of HERG K+ channel by an antihistamine drug brompheniramine requires the channel binding within the S6 residue Y652 and F656." J Appl Toxicol. 28(2):104-111. PMID:17516459 - [
] Perry M, et al. (2008) "A single amino acid difference between ether-a-go-go- related gene channel subtypes determines differential sensitivity to a small molecule activator." Mol Pharmacol. 73(4):1044-1051. PMID:18162604 - [
] Gentile S, et al. (2008) "The human ERG1 channel polymorphism, K897T, creates a phosphorylation site that inhibits channel activity." Proc Natl Acad Sci U S A. 105(38):14704-14708. PMID:18791070 - [
] Hancox JC, et al. (2008) "The hERG potassium channel and hERG screening for drug-induced torsades de pointes." Pharmacol Ther. 119(2):118-132. PMID:18616963 - [
] Nanduri J, et al. (2008) "Mitochondrial reactive oxygen species mediate hypoxic down-regulation of hERG channel protein." Biochem Biophys Res Commun. 373(2):309-314. PMID:18570888
Acute changes in cAMP and protein kinase A (PKA) signaling can regulate ion channel protein activities such as gating. Effects on channels due to chronic PKA signaling, as in stress or disease states, are less understood. We examined the effects of prolonged PKA activity on the human ether-a-go-go-related gene (HERG) K(+) channel in stably transfected human embryonic kidney (HEK)293 cells. Sustained elevation of cAMP by either chlorophenylthiol (CPT)-cAMP or forskolin increased the HERG channel protein abundance two- to fourfold within 24 h, with measurable difference as early as 4 h. The cAMP-induced augmentation was not due to changes in transcription and was specific for HERG compared with other cardiac K(+) channels (Kv1.4, Kv1.5, Kir2.1, and KvLQT1). PKA activity was necessary for the effect on HERG protein and did not involve other cAMP signaling pathways. Direct PKA phosphorylation of the HERG protein was responsible for the cAMP-induced augmentation. Enhanced abundance of HERG protein was detected in endoplasmic reticulum-enriched, Golgi, and plasma membrane without significant changes in trafficking rates or patterns. An increase in the K(+) current density carried by the HERG channel was also observed, but with a delay, suggesting that traffic to the surface is rate-limiting traffic. Acceleration of the HERG protein synthesis rate was the primary factor in the cAMP/PKA effect with lesser effects on protein stability. These results provide evidence for a novel mechanism whereby phosphorylation of a nascent protein dictates its rate of synthesis, resetting its steady-state abundance.
QT interval duration, reflecting myocardial repolarization on the electrocardiogram, is a heritable risk factor for sudden cardiac death and drug-induced arrhythmias. We conducted a meta-analysis of three genome-wide association studies in 13,685 individuals of European ancestry from the Framingham Heart Study, the Rotterdam Study and the Cardiovascular Health Study, as part of the QTGEN consortium. We observed associations at P < 5 x 10(-8) with variants in NOS1AP, KCNQ1, KCNE1, KCNH2 and SCN5A, known to be involved in myocardial repolarization and mendelian long-QT syndromes. Associations were found at five newly identified loci, including 16q21 near NDRG4 and GINS3, 6q22 near PLN, 1p36 near RNF207, 16p13 near LITAF and 17q12 near LIG3 and RFFL. Collectively, the 14 independent variants at these 10 loci explain 5.4-6.5% of the variation in QT interval. These results, together with an accompanying paper, offer insights into myocardial repolarization and suggest candidate genes that could predispose to sudden cardiac death and drug-induced arrhythmias.
A cohort of 52 French unrelated infant cases who died unexpectedly before they reached 12 months of age was blindly investigated to better quantify the contribution of long-QT syndrome (LQTS) genetic variants in French cases of sudden infant death syndrome (SIDS). After a standardized autopsy protocol, a blinded molecular screening of the KCNQ1, KCNH2, SCN5A, KCNE1, and KCNE2 genes was performed on each case. These postmortem investigations enabled us to reclassify 18 as non-SIDS cases, 32 as SIDS cases, and 2 as suspected SIDS cases. Among the 18 non-SIDS cases, no LQTS mutation was identified. In contrast, our results led to a possible explanation for the death of at least three infants in the SIDS cohort. Half of the LQTS gene variants identified were located on the SCN5A gene. This study confirms that LQTS mutations may represent one of the leading genetic causes of SIDS. If autopsy fails to provide an explanation for an unexplained infant death, medicolegal investigation should be extended with a molecular screening of major LQTS genes. Identification of more LQTS mutations in SIDS cases could provide new insights into the pathophysiology of SIDS and, consequently, reduce the number of unexplained sudden infant deaths.
BACKGROUND: Genetic variants in myocardial sodium and potassium channel genes are associated with prolonged QT interval and increased risk of sudden death. It is unclear whether these genetic variants remain relevant in subjects with underlying conditions such as diabetes that are associated with prolonged QT interval. METHODS: We tested single nucleotide polymorphisms (SNPs) in five candidate genes for association with QT interval in a family-based study of subjects with type 2 diabetes mellitus (T2DM). Thirty-six previously reported SNPs were genotyped in KCNQ1, HERG, SCN5A, KCNE1, and KCNE2 in 901 European Americans from 366 families. The heart rate-corrected (QTc) durations were determined using the Marquette 12SL program. Associations between the QTc interval and the genotypes were evaluated using SOLAR adjusting for age, gender, T2DM status, and body mass index. RESULTS: Within KCNQ1 there was weak evidence for association between the minor allele of IVS12 +14T>C and increased QTc (P = 0.02). The minor allele of rs2236609 in KCNE1 trended toward significance with longer QTc (P = 0.06), while the minor allele of rs1805123 in HERG trended toward significance with shorter QTc (P = 0.07). However, no statistically significant associations were observed between the remaining SNPs and QTc variation. CONCLUSIONS: We found weak evidence of association between three previously reported SNPs and QTc interval duration. While it appears as though genetic variants in previously identified candidate genes may be associated with QT duration in subjects with diabetes, the clinical implications of these associations in diabetic subjects at high risk for sudden death remain to be determined.
The functional role of the large intracellular regions (which include the cyclic nucleotide binding domain, cNBD, and the Per-Arnt-Sim domain, PAS) in the herg channel is not well understood. We have studied possible interactions of the cNBD with other parts of the channel protein using lysine mutations to disrupt such interactions. Some lysine mutations caused significant right shifts in the voltage dependence of inactivation; almost all the mutants caused speeding up of deactivation time course. In a homology model of the cNBD, lysine mutations that affected both inactivation and deactivation lie in a hydrophobic band on the surface of the structure of this domain. Some known mutations in the Long QT Syndrome type 2, with effects on deactivation, are located at residues close to hydrophobic bands on the cNBD and the PAS domains. Such bands of residues in these intracellular domains may play an important part in channel function.
The QT interval, a measure of cardiac repolarization, predisposes to ventricular arrhythmias and sudden cardiac death (SCD) when prolonged or shortened. A common variant in NOS1AP is known to influence repolarization. We analyze genome-wide data from five population-based cohorts (ARIC, KORA, SardiNIA, GenNOVA and HNR) with a total of 15,842 individuals of European ancestry, to confirm the NOS1AP association and identify nine additional loci at P < 5 x 10(-8). Four loci map near the monogenic long-QT syndrome genes KCNQ1, KCNH2, SCN5A and KCNJ2. Two other loci include ATP1B1 and PLN, genes with established electrophysiological function, whereas three map to RNF207, near LITAF and within NDRG4-GINS3-SETD6-CNOT1, respectively, all of which have not previously been implicated in cardiac electrophysiology. These results, together with an accompanying paper from the QTGEN consortium, identify new candidate genes for ventricular arrhythmias and SCD.
Organized neuronal firing is crucial for cortical processing and is disrupted in schizophrenia. Using rapid amplification of 5' complementary DNA ends in human brain, we identified a primate-specific isoform (3.1) of the ether-a-go-go-related K(+) channel KCNH2 that modulates neuronal firing. KCNH2-3.1 messenger RNA levels are comparable to full-length KCNH2 (1A) levels in brain but three orders of magnitude lower in heart. In hippocampus from individuals with schizophrenia, KCNH2-3.1 expression is 2.5-fold greater than KCNH2-1A expression. A meta-analysis of five clinical data sets (367 families, 1,158 unrelated cases and 1,704 controls) shows association of single nucleotide polymorphisms in KCNH2 with schizophrenia. Risk-associated alleles predict lower intelligence quotient scores and speed of cognitive processing, altered memory-linked functional magnetic resonance imaging signals and increased KCNH2-3.1 mRNA levels in postmortem hippocampus. KCNH2-3.1 lacks a domain that is crucial for slow channel deactivation. Overexpression of KCNH2-3.1 in primary cortical neurons induces a rapidly deactivating K(+) current and a high-frequency, nonadapting firing pattern. These results identify a previously undescribed KCNH2 channel isoform involved in cortical physiology, cognition and psychosis, providing a potential new therapeutic drug target.
AIMS: Long QT syndrome (LQTS) is an inherited arrhythmia disorder with an estimated prevalence of 0.01%-0.05%. In Finland, four founder mutations constitute up to 70% of the known genetic spectrum of LQTS. In the present survey, we sought to estimate the actual prevalence of the founder mutations and to determine their effect sizes in the general Finnish population. METHODS AND RESULTS: We genotyped 6334 subjects aged > or =30 years from a population cohort (Health 2000 study) for the four Finnish founder mutations using Sequenom MALDI-TOF mass spectrometry. The electrocardiogram (ECG) parameters were measured from digital 12-lead ECGs, and QT intervals were adjusted for age, sex, and heart rate using linear regression. A total of 27 individuals carried one of the founder mutations resulting in their collective prevalence estimate of 0.4% (95% CI 0.3%-0.6%). The KCNQ1 G589D mutation (n=8) was associated with a 50 ms (SE 7.0) prolongation of the adjusted QT interval (P=9.0x10(-13)). The KCNH2 R176W variant (n=16) resulted in a 22 ms (SE 4.7) longer adjusted QT interval (P=2.1x10(-6)). CONCLUSION: In Finland 1 individual out of 250 carries a LQTS founder mutation, which is the highest documented prevalence of LQTS mutations that lead to a marked QT prolongation.
The pro-arrhythmic Long QT syndrome (LQT) is linked to 10 different genes (LQT1-10). Approximately 40% of genotype-positive LQT patients have LQT2, which is characterized by mutations in the human ether-a-go-go related gene (hERG). hERG encodes the voltage-gated K(+) channel alpha-subunits that form the pore of the rapidly activating delayed rectifier K(+) current in the heart. The purpose of this study was to elucidate the mechanisms that regulate the intracellular transport or trafficking of hERG, because trafficking is impaired for about 90% of LQT2 missense mutations. Protein trafficking is regulated by small GTPases. To identify the small GTPases that are critical for hERG trafficking, we coexpressed hERG and dominant negative (DN) GTPase mutations in HEK293 cells. The GTPases Sar1 and ARF1 regulate the endoplasmic reticulum (ER) export of proteins in COPII and COPI vesicles, respectively. Expression of DN Sar1 inhibited the Golgi processing of hERG, decreased hERG current (I(hERG)) by 85% (n > or = 8 cells per group, *, p < 0.01), and reduced the plasmalemmal staining of hERG. The coexpression of DN ARF1 had relatively small effects on hERG trafficking. Surprisingly, the coexpression of DN Rab11B, which regulates the endosomal recycling, inhibited the Golgi processing of hERG, decreased I(hERG) by 79% (n > or = 8 cells per group; *, p < 0.01), and reduced the plasmalemmal staining of hERG. These data suggest that hERG undergoes ER export in COPII vesicles and endosomal recycling prior to being processed in the Golgi. We conclude that hERG trafficking involves a pathway between the ER and endosomal compartments that influences expression in the plasmalemma.
Human ether-a-go-go-related gene (HERG) potassium channel acts as a delayed rectifier in cardiac myocytes and is an important target for both pro- and antiarrhythmic drugs. Many drugs have been pulled from the market for unintended HERG block causing arrhythmias. Conversely, recent evidence has shown that HERG plays a role in cell proliferation and is overexpressed both in multiple tumor cell lines and in primary tumor cells, which makes HERG an attractive target for cancer treatment. Therefore, a drug that can block HERG but that does not induce cardiac arrhythmias would have great therapeutic potential. Roscovitine is a cyclin-dependent kinase (CDK) inhibitor that is in phase II clinical trials as an anticancer agent. In the present study we show that R-roscovitine blocks HERG potassium current (human embryonic kidney-293 cells stably expressing HERG) at clinically relevant concentrations. The block (IC(50) = 27 microM) was rapid (tau = 20 ms) and reversible (tau = 25 ms) and increased with channel activation, which supports an open channel mechanism. Kinetic study of wild-type and inactivation mutant HERG channels supported block of activated channels by roscovitine with relatively little effect on either closed or inactivated channels. A HERG gating model reproduced all roscovitine effects. Our model of open channel block by roscovitine may offer an explanation of the lack of arrhythmias in clinical trials using roscovitine, which suggests the utility of a dual CDK/HERG channel block as an adjuvant cancer therapy.
OBJECTIVES: QT interval prolongation is associated with increased risk of sudden cardiac death at the population level. As 30-40% of the QT-interval variability is heritable, we tested the association of common LQTS and NOS1AP gene variants with QT interval in a Finnish population-based sample. METHODS: We genotyped 12 common LQTS and NOS1AP genetic variants in Health 2000, an epidemiological sample of 5043 Finnish individuals, using Sequenom MALDI-TOF mass spectrometry. ECG parameters were measured from digital 12-lead ECGs and QT intervals were adjusted for age, gender and heart rate with a nomogram (Nc) method derived from the present study population. RESULTS: The KCNE1 D85N minor allele (frequency 1.4%) was associated with a 10.5 ms (SE 1.6) or 0.57 SD prolongation of the adjusted QT(Nc) interval (P=3.6 x 10(-11)) in gender-pooled analysis. In agreement with previous studies, we replicated the association with QT(Nc) interval with minor alleles of KCNH2 intronic SNP rs3807375 [1.6 ms (SE 0.4) or 0.08 SD, P=4.7 x 10(-5)], KCNH2 K897T [-2.6 ms (SE 0.5) or -0.14 SD, P=2.1 x 10(-7)] and NOSA1P variants including rs2880058 [4.0 ms (SE 0.4) or 0.22 SD, P=3.2 x 10(-24)] under additive models. CONCLUSIONS: We demonstrate that each additional copy of the KCNE1 D85N minor allele is associated with a considerable 10.5 ms prolongation of the age-, gender- and heart rate-adjusted QT interval and could thus modulate repolarization-related arrhythmia susceptibility at the population level. In addition, we robustly confirm the previous findings that three independent KCNH2 and NOSA1P variants are associated with adjusted QT interval.
BACKGROUND: In the LQT2 form of long QT syndrome (LQTS), mutation sites are reported to correlate with clinical phenotypes in Caucasians, but the relationship in Asian patients remains unknown. The present study was designed to determine whether the location of KCNH2 mutations would influence the arrhythmic risk in LQT2 patients. METHODS AND RESULTS: In 118 genetically-confirmed LQT2 patients (69 families, 62 KCNH2 mutations), the ECG parameters, Schwartz scores, and the incidence of cardiac events, defined as syncope, aborted cardiac arrest, and sudden cardiac death, were evaluated. To examine the effect of mutation sites, the participants were divided accordingly: pore (n=56) and non-pore (n=62) groups. The corrected QTend interval was significantly greater in the pore than in the non-pore group (QTc; 522+/-63 ms vs 490+/-49 ms, p=0.002). In this study, the clinical course of each of the probands did not differ according to the mutation sites, whereas non-probands carrying the pore site mutation experienced their first cardiac events at significantly younger age than those with the non-pore site mutation (log-rank, p=0.0005). CONCLUSIONS: In a Japanese LQT2 cohort, family members with the pore site mutation were at higher arrhythmic risk than those with the non-pore site mutation.
I (Kr) is the fast component of the delayed rectifier potassium currents responsible for the repolarization of the cardiac muscle. The molecular correlate underlying the I (Kr) current has been identified as the hERG1 channel. Recently, two splice variants of the hERG1 alpha-subunit, hERG1a and hERG1b, have been shown to be co-expressed in human cardiomyocytes. In this paper, we present the electrophysiological characterization of hERG1a, hERG1b, and co-expressed hERG1a/b channels in a mammalian expression system using the whole-cell patch clamp technique. We also quantified the messenger RNA (mRNA) levels of hERG1a and hERG1b in human cardiac tissue, and based on the expressed ratios, we evaluated the resulting currents in Xenopus laevis oocytes. Compared to hERG1a channels, activation was faster for both hERG1b and hERG1a/b channels. The deactivation kinetics was greatly accelerated in the presence of hERG1b, whereas no difference in the time constant of inactivation was observed. The voltage-dependent recovery from inactivation was also similar. However, the time constant of recovery from inactivation was significantly faster for hERG1b channels compared to hERG1a and hERG1a/b. Quantification of hERG1a and hERG1b mRNA in the human heart showed that hERG1b mRNA constitutes, on average, 19% in the right atrium and 12% in the left ventricle of the total hERG1 mRNA. Expression of the observed ratios of hERG1a to hERG1b in X. laevis oocytes showed that these ratios are indeed sufficient to change the deactivation phenotype markedly. The present work suggests that hERG1b is likely to play a role in the formation of the native I (Kr) current.
A variety of compounds with different chemical properties directly interact with the cardiac repolarizing K(+) channel encoded by the human ether-a-go-go-related gene (hERG). This causes acquired forms of QT prolongation, which can result in lethal cardiac arrhythmias including torsades de pointes one of the most serious adverse effects of various therapeutic agents. Prediction of this phenomenon will improve the safety of pharmacological therapy and also facilitate the process of drug development. Here we propose a strategy for the development of an in silico system to predict the potency of chemical compounds to block hERG. The system consists of two sequential processes. The first process is a ligand-based prediction to estimate half-maximal concentrations for the block of compounds inhibiting hERG current using the relationship between chemical features and activities of compounds. The second process is a protein-based prediction that comprises homology modeling of hERG, docking simulation of chemical-channel interaction, analysis of the shape of the channel pore cavity, and Brownian dynamics simulation to estimate hERG currents in the presence and absence of chemical blockers. Since each process is a combination of various calculations, the criterion for assessment at each calculation and the strategy to integrate these steps are significant for the construction of the system to predict a chemical's block of hERG current and also to predict the risk of inducing cardiac arrhythmias from the chemical information. The principles and criteria of elemental computations along this strategy are described.
Block of cardiac hERG K+ channels by the antihistamine terfenadine and the prokinetic agent cisapride is associated with prolonged ventricular repolarization and an increased risk of ventricular arrhythmia. Here, we used a site-directed mutagenesis approach to determine the molecular determinants of hERG block by terfenadine and cisapride. Wild-type and mutant hERG channels were heterologously expressed in Xenopus laevis oocytes and characterized by measuring whole cell currents with two-microelectrode voltage clamp techniques. Mutation of T623, S624, Y652, or F656 to Ala reduced channel sensitivity to block by terfenadine. The same mutations reduced sensitivity to cisapride. These data confirm our previous findings that polar residues (T623, S624) located near the base of the pore helix and aromatic residues (Y652, F656) located in the S6 domain are key molecular determinants of the hERG drug binding site. Unlike methanesulfonanilides (dofetilide, MK-499, E-4031, ibutilide) or clofilium, mutation of V625, G648, or V659 did not alter the sensitivity of hERG channels to terfenadine or cisapride. As previously proposed by molecular modeling studies (Farid R, et al. Bioorg Med Chem. 2006;14:3160-3173), our findings suggest that different drugs can adopt distinct modes of binding to the central cavity of hERG.
BACKGROUND: KCNQ1 and KCNH2 are the two most common potassium channel genes causing long QT syndrome (LQTS), an inherited cardiac arrhythmia featured by QT prolongation and increased risks of developing torsade de pointes and sudden death. To investigate the disease expressivity, this study aimed to identify mutations and common variants that can modify LQTS phenotype. METHODS: In this study, a cohort of 112 LQTS families were investigated. Among them two large LQTS families linkage analysis with markers spanning known LQTS genes was carried out to identify the specific gene for mutational analysis. All exons and exon-intron boundaries of KCNH2 and KCNQ1 were sequenced for mutational analysis. RESULTS: LQTS-associated mutations were identified in eight of 112 families. Two novel mutations, L187P in KCNQ1 and 2020insAG in KCNH2, were identified. Furthermore, in another LQTS family we found that KCNH2 mutation A490T co-segregated with a common SNP K897T in KCNH2. KCNH2 SNP K897T was reported to exert a modifying effect on QTc, but it remains controversial whether it confers a risk or protective effect. Notably, we have found that SNP K897T interacts with mutation A490T in cis orientation. Seven carriers for A490T and the minor allele T of SNP K897T showed shorter QTc and fewer symptoms than carriers with A490T or A490P (P < 0.0001). CONCLUSION: Our family-based approach provides support that KCNH2 SNP K897T confers a protective effect on LQTS patients. Our study is the first to investigate the effect of SNP K897T on another KCNH2 mutation located in cis orientation. Together, our results expand the mutational and clinical spectrum of LQTS and provide insights into the factors that determine QT prolongation associated with increased risk of ventricular tachycardia and sudden death.
Protein-protein interaction plays a key role in the regulation of biological processes. The human potassium (HERG) channel is encoded by the ether-a-go-go-related gene (herg), and its activity may be regulated by association with other cellular proteins. To identify cellular proteins that might play a role in the regulation of the HERG channel, we screened a human heart cDNA library with the N terminus of HERG using a yeast 2-hybrid system, and identified caveolin-1 as a potential HERG partner. The interaction between these 2 proteins was confirmed by coimmunoprecipitation assay, and their overlapping subcellular localization was demonstrated by fluorescence immunocytochemistry. The physiologic implication of the protein-protein interaction was studied in whole-cell patch-clamp electrophysiology experiments. A significant increase in HERG current amplitude and a faster deactivation of tail current were observed in HEK293/HERG cells in a membrane lipid rafts disruption model and caveolin-1 knocked down cells by RNA interference. Alternatively, when caveolin-1 was overexpressed, the HERG current amplitude was significantly reduced and the tail current was deactivated more slowly. Taken together, these data indicate that HERG channels interact with caveolin-1 and are negatively regulated by this interaction. The finding from this study clearly demonstrates the regulatory role of caveolin-1 on HERG channels, and may help to understand biochemical events leading to arrhythmogenesis in the long QT syndrome in cardiac patients.
A common over-the-counter (OTC) non-opioid antitussive drug, clobutinol, was recently withdrawn from the market due to its potential to induce cardiac arrhythmias by a blockade of the potassium channel coded by the human ether-a-go-go-related gene (hERG). In this study, we investigated the effects of a number of antitussive compounds on the hERG ion channel current using patch-clamp electrophysiology, and compared the effects to that of clobutinol. The compounds clobutinol, pentoxyverine, dextromethorphan, and codeine inhibited the outward current in hERG transfected cells with half-maximal inhibition concentrations (IC50) of 1.9 microM, 3.0 microM, 5.1 microM, and 97 microM, respectively. For theobromine, no significant effect on the hERG current at a concentration up to 100 microM was detected. Safety margins between the effects of the drugs on the hERG ion channel current and their calculated maximal free therapeutic plasma concentration were calculated. These results were compared to assess potential risks of the compounds to induce torsade de pointes-type arrhythmias.
Mutations in the KCNQ1, HERG, SCN5A, minK and MiRP1 genes cause long QT syndrome (LQTS), of which there are two forms: the Romano Ward syndrome and the Jervell and Lange-Nielsen syndrome. We have performed DNA sequencing of the LQTS-associated genes in 169 unrelated patients referred for genetic testing with respect to Romano Ward syndrome and in 13 unrelated patients referred for genetic testing with respect to Jervell and Lange-Nielsen syndrome. A total of 37 different mutations in the 5 genes, of which 20 were novel, were identified. Among patients with the most stringent clinical criteria of Romano Ward syndrome, a mutation was identified in 71 %. Twelve of the 13 unrelated patients referred for genetic testing with respect to Jervell and Lange-Nielsen syndrome were provided with a molecular genetic diagnosis. Cascade genetic screening of 505 relatives of index patients with molecularly defined LQTS identified 251 mutation carriers. The observed penetrance was 41 %. Although caution must be exerted, the prevalence of heterozygotes for mutations in the LQTS-associated genes in Norway could be in the range 1/100-1/300, based on the prevalence of patients with Jervell and Lange-Nielsen syndrome.
BACKGROUND: Inherited arrhythmias may underlie intrauterine and neonatal arrhythmias. Resolving the molecular genetic nature of these rare cases provides significant insight into the role of the affected proteins in arrhythmogenesis and (extra-) cardiac development. OBJECTIVE: The purpose of this study was to perform clinical, molecular, and functional studies of a consanguineous Arabian family with repeated early miscarriages and two intrauterine fetal losses in the early part of the third trimester of pregnancy due to persistent arrhythmias. METHODS: In-depth clinical investigation was performed in two siblings, both of whom developed severe arrhythmia during the second trimester of pregnancy. Homozygosity mapping with microsatellite repeat polymorphic markers encompassing various cardiac ion channel genes linked to electrical instability of the heart was performed. Screening of the candidate gene in the homozygous locus was performed. Biochemical and electrophysiologic analysis was performed to elucidate the function of the mutated gene. RESULTS: Screening of the HERG gene in the homozygous locus detected a homozygous nonsense mutation Q1070X in the HERG C-terminus in affected children. Biochemical and functional analysis of the Q1070X mutant showed that although the mutant HERG had the ability to traffic to the plasma membrane and to form functional channels, it was destroyed by the nonsense-mediated decay (NMD) pathway before its translation. NMD leads to near absence of HERG in homozygous Q1070X mutation carriers, causing debilitating arrhythmias (prior to birth) in homozygous carriers but no apparent phenotype in heterozygous carriers. CONCLUSION: Homozygous HERG Q1070X is equivalent to near functional knockout of HERG. Clinical consequences appear early, originating during the early stages of embryonic life. The NMD pathway renders HERG Q1070X functionless before it can form a functional ion channel.
BACKGROUND: Sequencing or denaturing high-performance liquid chromatography (dHPLC) analysis of the known genes associated with the long QT syndrome (LQTS) fails to identify mutations in approximately 25% of subjects with inherited LQTS. Large gene deletions and duplications can be missed with these methodologies. OBJECTIVE: The purpose of this study was to determine whether deletions and/or duplications of one or more exons of the main LQTS genes were present in an LQTS mutation-negative cohort. METHODS: Multiplex ligation-dependent probe amplification (MLPA), a quantitative fluorescent approach, was used to screen 26 mutation-negative probands with an unequivocal LQTS phenotype (Schwartz score >4). The appropriate MLPA kit contained probes for selected exons in LQTS genes KCNQ1, KCNH2, SCN5A, KCNE1, and KCNE2. Real-time polymerase chain reaction was used to validate the MLPA findings. RESULTS: Altered exon copy number was detected in 3 (11.5%) patients: (1) an ex13-14del of the KCNQ1 gene in an 11-year-old boy with exercise-induced collapse (QTc 580 ms); (2) an ex6-14del of the KCNH2 gene in a 22-year-old woman misdiagnosed with epilepsy since age 9 years (QTc 560 ms) and a sibling with sudden death at age 13 years; and (3) an ex9-14dup of the KCNH2 gene in a 12 year-old boy (QTc 550 ms) following sudden nocturnal death of his 32-year-old mother. CONCLUSION: If replicated, this study demonstrates that more than 10% of patients with LQTS and a negative current generation genetic test have large gene deletions or duplications among the major known LQTS susceptibility genes. As such, these findings suggest that sequencing-based mutation detection strategies should be followed by deletion/duplication screening in all LQTS mutation-negative patients.
Type 2 congenital long QT syndrome (LQT-2) is linked to mutations in the human ether a-go-go-related gene (HERG) and is characterized by rate-corrected QT interval (QTc) prolongation, ventricular arrhythmias, syncope, and sudden death. Recognized triggers of these cardiac events include emotional and acoustic stimuli. Here we investigated the repeated occurrence of fever-induced polymorphic ventricular tachycardia and ventricular fibrillation in 2 LQT-2 patients with A558P missense mutation in HERG. ECG analysis showed increased QTc with fever in both patients. WT, A558P, and WT+A558P HERG were expressed heterologously in HEK293 cells and were studied using biochemical and electrophysiological techniques. A558P proteins showed a trafficking-deficient phenotype. WT+A558P coexpression caused a dominant-negative effect, selectively accelerated the rate of channel inactivation, and reduced the temperature-dependent increase in the WT current. Thus, the WT+A558P current did not increase to the same extent as the WT current, leading to larger current density differences at higher temperatures. A similar temperature-dependent phenotype was seen for coexpression of the trafficking-deficient LQT-2 F640V mutation. We postulate that the weak increase in the HERG current density in WT-mutant coassembled channels contributes to the development of QTc prolongation and arrhythmias at febrile temperatures and suggest that fever is a potential trigger of life-threatening arrhythmias in LQT-2 patients.
BACKGROUND: Mexiletine may protect patients with long QT syndrome (LQTS) type 3 from arrhythmias. However, we found an unusual in utero presentation of intermittent atrioventricular block and ventricular tachycardia (spontaneous or lidocaine-induced) in a fetus and his sibling with LQTS. OBJECTIVE: The purpose of this study was to investigate the underlying channelopathy and functional alteration. METHODS: Mutations were searched in KCNQ1, HERG, KCNE1, KCNE2, and SCN5A genes. In expressed mutants, whole-cell voltage clamp defined the electrophysiologic properties. RESULTS: Novel missense mutations involving hERG (F627L) at the pore region and SCN5A (R43Q) at the N-terminus were found in the proband and in family members with prolonged QT interval. In oocytes injected with mRNA encoding hERG/ F627L, almost zero K(+) currents were elicited. In coinjected oocytes, the currents were decreased to half. In tsA201 cells transfected with SCN5A/R43Q, although the baseline kinetics of the Na current were similar to wild type, lidocaine caused a unique hyperpolarizing shift of the activation and increased the availability of Na currents at resting voltages. Window currents were enhanced due to a right shift of steady-state inactivation. These electrophysiologic alterations after lidocaine may lead to the development of ventricular tachycardia. CONCLUSION: We identified a novel hERG/F627L mutation that results in LQTS with fetal onset of atrioventricular block and ventricular tachycardia. A coexisting SCN5A/R43Q variant, although it per se does not prolong repolarization, contributes to the development of ventricular tachyarrhythmias after lidocaine. Patients with such latent lidocaine-induced phenotype who are given lidocaine or mexiletine may be at risk.
Loss-of-function mutations in the human ERG1 potassium channel (hERG1) frequently underlie the long QT2 (LQT2) syndrome. The role of the ERG potassium channel in cardiac development was elaborated in an in vivo model of a homozygous, loss-of-function LQT2 syndrome mutation. The hERG N629D mutation was introduced into the orthologous mouse gene, mERG, by homologous recombination in mouse embryonic stem cells. Intact homozygous embryos showed abrupt cessation of the heart beat. N629D/N629D embryos die in utero by embryonic day 11.5. Their developmental defects include altered looping architecture, poorly developed bulbus cordis, and distorted aortic sac and branchial arches. N629D/N629D myocytes from embryonic day 9.5 embryos manifested complete loss of I(Kr) function, depolarized resting potential, prolonged action potential duration (LQT), failure to repolarize, and propensity to oscillatory arrhythmias. N629D/N629D myocytes manifest calcium oscillations and increased sarcoplasmic reticulum Ca(+2) content. Although the N629D/N629D protein is synthesized, it is mainly located intracellularly, whereas +/+ mERG protein is mainly in plasmalemma. N629D/N629D embryos show robust apoptosis in craniofacial regions, particularly in the first branchial arch and, to a lesser extent, in the cardiac outflow tract. Because deletion of Hand2 produces apoptosis, in similar regions and with a similar final developmental phenotype, Hand2 expression was evaluated. Robust decrease in Hand2 expression was observed in the secondary heart field in N629D/N629D embryos. In conclusion, loss of I(Kr) function in N629D/N629D cardiovascular system leads to defects in cardiac ontogeny in the first branchial arch, outflow tract, and the right ventricle.
BACKGROUND: A novel mutation of hERG (A915fs+47X) was discovered in a 32-year-old woman with torsades de pointes, long QTc interval (515 ms), and syncope upon auditory trigger. OBJECTIVE: We explored whether the properties of this mutation could explain the pathology. METHODS: Whole-cell A915fs+47X (del) and wild-type (WT) currents were recorded in transiently transfected COS7 cells or Xenopus oocytes. Western blots and sedimentation analysis of del/WT hERG were used to analyze protein expression, assembly, and trafficking. RESULTS: The tail current density at -40 mV after a 2-s depolarization to +40 mV in COS7 cells expressing del was 36% of that for WT. Inactivation was 1.9-fold to 2.8-fold faster in del versus WT between -60 and +60 mV. In the range -60 to -10 mV, we found that a nondeactivating fraction of current was increased in del at the expense of a rapidly deactivating fraction, with a slowly deactivating fraction being unchanged. In Xenopus oocytes, expression of del alone produced 38% of WT currents, whereas coexpression of 1/2 WT + 1/2 del produced 49.8%. Furthermore, the expression of del protein at the cell surface was reduced by about 50%. This suggests that a partial trafficking defect of del contributes to the reduction in del current densities and to the dominant negative effect when coexpressed with WT. In model simulations, the mutation causes a 10% prolongation of action potential duration. CONCLUSION: Decreased current levels caused by a trafficking defect may explain the long QT syndrome observed in our patient.
BACKGROUND: Many studies revealed that variations in cardiac ion channels would cause cardiac arrhythmias or act as genetic risk factors. We hypothesized that specific single nucleotide polymorphisms in cardiac ion channels were associated with cardiac rhythm disturbance in the Chinese population. METHOD: We analyzed 160 nonfamilial cardiac arrhythmia patients and 176 healthy individuals from which 81 individuals were selected for association study, and a total of 19 previously reported SNPs in four cardiac ion channel genes (KCNQ1, KCNH2, SCN5A, KCNE1) were genotyped. RESULTS: The frequency of KCNQ1 1638G>A, as well as the haplotype harboring KCNQ1 1638A, KCNQ1 1685 + 23G and 1732 + 43T (haplotype AGT) was significantly higher in healthy controls than in arrhythmia patients. This finding implicated that this haplotype (AGT) might be a protective factor against arrhythmias. CONCLUSIONS: Our study provided important information to elucidate the effect of SNPs of cardiac ion channel genes on channel function and susceptibility to cardiac arrhythmias in Chinese population.
OBJECTIVE: Cardiac repolarization is regulated, in part, by the KCNH2 gene, which encodes a rapidly activating component of the delayed rectifier potassium channel. The gene expresses a functional single nucleotide polymorphism, K897T, which changes the biophysical properties of the channel. The objective of this study was to evaluate whether this polymorphism influences two indices of repolarization--the QT interval and T-wave alternans (TWA)--during different phases of a physical exercise test. MATERIAL AND METHODS: The cohort consisted of 1,975 patients undergoing an exercise test during which on-line electrocardiographic data were registered. Information on coronary risk factors and medication was recorded. The 2690A>C nucleotide variation in the KCNH2 gene corresponding to the K897T amino acid change was analysed after polymerase chain reaction with allele-specific TaqMan probes. RESULTS: Among all subjects, the QTc intervals did not differ between the three genotype groups (p> or =0.31, RANOVA). Women with the CC genotype tended to have longer QT intervals during the exercise test, but the difference was statistically significant only at rest (p = 0.011, ANOVA). This difference was also detected when the analysis was adjusted for several factors influencing the QT interval. No statistically significant effects of the K897T polymorphism on TWA were observed among all subjects (p = 0.16, RANOVA), nor in men and women separately. CONCLUSIONS: The K897T polymorphism of the KCNH2 gene may not be a major genetic determinant for the TWA, but the influence of the CC genotype on QT interval deserves further research among women.
BACKGROUND: C-terminal KCNH2 mutations are commonly associated with a more benign clinical presentation, but mutations localized in close proximity may exhibit different clinical and biophysical phenotypes. The value of detailed cellular characterization of such mutant channels in vitro has not been studied with respect to clinical risk stratification of affected patients. OBJECTIVE: The purpose of this study was to study the cellular properties and clinical presentation of C-terminal KCNH2 missense mutations localized in close proximity. METHODS: Unrelated female index patients with KCNH2 mutations and heterogeneous clinical presentation were identified. Mutations were studied in vitro with biophysical and molecular biology techniques. RESULTS: Ionic currents from all three mutants were reduced compared with wild type. Coexpression experiments mimicking heterozygosity indicated haploinsufficiency as the mechanism of current suppression in all cases. One mutation (R954C) was associated with reversible QTc prolongation during macrolide treatment (QTc approximately 600 ms). Biophysical properties included reduced current amplitude, accelerated deactivation, and altered activation voltage dependence. The patient affected by L955V suffered from recurrent syncope (QTc approximately 460 ms), and this mutation led to greatly reduced current and reduced KCNH2 protein in plasma membrane preparations. Confocal microscopy supported these findings, suggesting aggregate formation and endoplasmic reticulum retention by L955V. The mutation carrier of G1036D (QTc approximately 530 ms) was resuscitated from cardiac arrest, but biophysical characteristics were less strongly affected. CONCLUSION: The results of our study provide evidence that C-terminal mutations localized in proximity to each other may exhibit strongly different and poorly correlated clinical and cellular phenotypes. These findings provide evidence that even detailed characterization of long QT syndrome mutations may not provide additional definitive information for clinical risk stratification.
The human Ether-a-go-go Related Gene (hERG) potassium channel plays a central role in regulating cardiac excitability and maintenance of normal cardiac rhythm. Mutations in hERG cause a third of all cases of congenital long QT syndrome, a disorder of cardiac repolarisation characterised by prolongation of the QT interval on the surface electrocardiogram, abnormal T waves, and a risk of sudden cardiac death due to ventricular arrhythmias. Additionally, the hERG channel protein is the molecular target for almost all drugs that cause the acquired form of long QT syndrome. Advances in understanding the structural basis of hERG gating, its traffic to the cell surface, and the molecular architecture involved in drug-block of hERG, are providing the foundation for rational treatment and prevention of hERG associated long QT syndrome. This review summarises the current knowledge of hERG function and dysfunction, and the areas of ongoing research.
The intracellular N-terminus of human ether-a-go-go-related gene (HERG) potassium channels constitutes a key determinant of activation and deactivation characteristics and is necessary for hormone-induced modifications of gating properties. However, the general organization of the long amino and carboxy HERG terminals remains unknown. In this study we performed fluorescence resonance energy transfer (FRET) microscopy with a library of fluorescent HERG fusion proteins obtained combining site-directed and transposon-based random insertion of GFP variants into multiple sites of HERG. Determinations of FRET efficiencies with functional HERG channels labeled in different combinations localize the fluorophores, introduced in the amino and carboxy ends, in two quadratic planes of 7.8 and 8.6 nm lateral size, showing a vertical separation of nearly 8 nm without major angular torsion between the planes. Similar analysis using labels at positions 345 and 905 of the amino and carboxy terminals, located them slightly above the planes delimited by the amino and carboxy end labels, respectively. Our data also indicate an almost vertical arrangement of the fluorophores introduced in the NH(2) and COOH ends and at position 905, but a near 45 degrees angular rotation between the planes delimited by these labels and the 345-located fluorophores. Systematic triangulation using interfluorophore distances coming from multiply labeled channels provides an initial constraint on the overall in vivo arrangement of the HERG cytoplasmic domains, suggesting that the C-linker/CNBD region of HERG hangs centrally below the transmembrane core, with the initial portion of the amino terminus around its top and side surfaces directed towards the gating machinery.
Protein-protein interactions are critical for protein trafficking, localization and the regulation of ion channels. The human ether-a-go-go-related gene (herg) encodes the alpha-subunit of the potassium channel underlying the rapid component of the cardiac delayed rectifier current. To identify the cellular proteins involved in the regulation of the HERG channel, a human heart cDNA library was screened using a yeast two-hybrid system, with the N-terminus of HERG as bait. The four and a half LIM domain protein 2 (FHL2) was identified as a potential HERG partner. The interaction between these two proteins was confirmed by co-immunoprecipitation and glutathione transferase pull-down assays and immunocytochemical analysis. The physiological implication of HERG-FHL2 interaction, assessed by whole-cell, patch-clamp electrophysiology experiments, showed a significant increase in the HERG current amplitude and a faster deactivation of the tail current in human embryonic kidney 293 cells co-expressing HERG and FHL2. These data indicate that FHL2 interacts with and regulates the HERG channel. Our findings may aid in the further understanding of the molecular basis of HERG channel diversity and arrhythmogenesis in the long-QT syndrome.
Cardiac I Kr is a critical repolarizing current in the heart and a target for inherited and acquired long-QT syndrome (LQTS). Biochemical and functional studies have demonstrated that I Kr channels are heteromers composed of both hERG 1a and 1b subunits, yet our current understanding of I Kr functional properties derives primarily from studies of homooligomers of the original hERG 1a isolate. Here, we examine currents produced by hERG 1a and 1a/1b channels expressed in HEK-293 cells at near-physiological temperatures. We find that heteromeric hERG 1a/1b currents are much larger than hERG 1a currents and conduct 80% more charge during an action potential. This surprising difference corresponds to a 2-fold increase in the apparent rates of activation and recovery from inactivation, thus reducing rectification and facilitating current rebound during repolarization. Kinetic modeling shows these gating differences account quantitatively for the differences in current amplitude between the 2 channel types. Drug sensitivity was also different. Compared to homomeric 1a channels, heteromeric 1a/1b channels were inhibited by E-4031 with a slower time course and a corresponding 4-fold shift in the IC50. The importance of hERG 1b in vivo is supported by the identification of a 1b-specific A8V missense mutation in 1/269 unrelated genotype-negative LQTS patients that was absent in 400 control alleles. Mutant 1bA8V expressed alone or with hERG 1a in HEK-293 cells dramatically reduced 1b protein levels. Thus, mutations specifically disrupting hERG 1b function are expected to reduce cardiac I Kr and enhance drug sensitivity, and represent a potential mechanism underlying inherited or acquired LQTS.
Sudden infant death syndrome (SIDS) is multifactorial and may result from the interaction of a number of environmental, genetic, and developmental factors. We studied three major genes causing long QT syndrome in 42 Japanese SIDS victims and found five mutations, KCNQ1-K598R, KCNH2-T895M, SCN5A-F532C, SCN5A-G1084S, and SCN5A-F1705S, in four cases; one case had both KCNH2-T895M and SCN5A-G1084S. All mutations were novel except for SCN5A-F532C, which was previously detected in an arrhythmic patient. Heterologous expression study revealed significant changes in channel properties of KCNH2-T895M, SCN5A-G1084S, and SCN5A-F1705S, but did not in KCNQ1-K598R and SCN5A-F532C. Our data suggests that nearly 10% of SIDS victims in Japan have mutations of the cardiac ion channel genes similar to in other countries.
Proarrhythmic drugs induce long QT syndrome more frequently in women than men. The present study was designed to determine whether androgens regulate the function and expression of the human ether-a-go-go-related gene (HERG) encoded K+ channel, which is largely responsible for determining the QT interval. In a concentration-dependent manner (10(-9) to 10(-6) M for 24 h), 5alpha-dihydrotestosterone (5alpha-DHT) increased HERG protein abundance in HEK293 cells stably expressing HERG in the presence of coexpressed cardiac androgen receptor (AR) variant [N-terminal truncated isoform of AR (AR45)]. The elevation of HERG protein was seen in endoplasmic reticulum, Golgi, and plasma membrane without clear preferential colocalization. Coexpression of the more common form of the AR did not confer 5alpha-DHT augmentation of HERG protein. Proteasome inhibitors, N-acetyl-L-leucyl-L-leucyl-L-norleucinal and MG132 prevented the 5alpha-DHT- dependent enhancement of HERG, as did the lysosome inhibitor, bafilomycin A1. Consistently, the cycloheximide-based protein chase study showed that 5alpha-DHT prolonged HERG protein half-life. 5alpha-DHT/AR45 signaling induced phosphorylation of ERK1/2. Blockade of ERK1/2 with PD98059 and U0126 prevented the effect of androgen on HERG protein abundance. Functional studies showed that 5alpha-DHT treatment for 24 h increased HERG K+ current density in Chinese hamster ovary cells cotransfected with cDNAs of AR45 and HERG channels. Moreover, 5alpha-DHT also increased ether-a-go-go-related gene-encoded K+ channel protein abundance in isolated rabbit cardiac myocytes. In conclusion, these data provide evidence that stimulation of AR45 receptors by androgens up-regulates HERG K+ channel abundance and activity mainly through stabilizing HERG protein in an ERK1/2 dependent mechanism, and suggest a mechanism to explain the sex difference in the long QT syndrome.
Overexpression of human ether-a-go-go (eag) related gene (herg) contributes to the progression and metastasis of a variety of tumors of different histogenesis, which implies that the herg gene could provide a promising target on tumor therapy. In the present study, plasmid-mediated expression of shRNA-herg1 and shRNA-herg1/1b was employed to silence the herg gene expression in human neuroblastoma SH-SY5Y cell lines. The inhibition of the target gene expression was confirmed by RT-PCR and Western blot. It was found that shRNA-herg1 or shRNA-herg1/1b depressed the cellular growth rate, inhibited cell viability and reduced colony formation of SH-SY5Y cells. The flow cytometry assay revealed that SH-SY5Y cells were retarded in G0-G1 after herg1 or herg1/1b gene was silenced by shRNA-herg1 or shRNA-herg1/1b. In vivo, intra-tumor injection of shRNA-herg1/1b inhibited the growth of SH-SY5Y tumors inoculated subcutaneously in nude mice. The result suggested that the herg played an important role in regulating the growth and proliferation of SH-SY5Y cells. The block of the HERG channel might be a potential therapeutic strategy for neuroblastoma and some other tumors with overexpression of the herg gene.
Long and short QT syndromes associated with loss and gain of human ether-a-go-go-related gene (hERG) channel activity, respectively, can cause life-threatening arrhythmias. As such, modulation of hERG channel activity is an important consideration in the development of all new therapeutic agents. In the present study, we investigated the mechanisms of action of 2-[2-(3,4-dichloro-phenyl)-2,3-dihydro-1H-isoindol-5-ylamino]-nicotinic acid (PD-307243), a known hERG channel activator, on hERG channels stably expressed in Chinese hamster ovary (CHO) cells using the patch-clamp technique. In the whole-cell recordings, the extracellular application of PD-307243 concentration-dependently increased the hERG current and markedly slowed hERG channel deactivation and inactivation. PD-307243 had no effect on the selectivity filter of hERG channels. The activity of PD-307243 was use-dependent. PD-307243 (3 and 10 muM) induced instantaneous hERG current with little decay at membrane potentials from -120 to -40 mV. At more positive voltages, PD-307243 induced an I(to)-like upstroke of hERG current. The actions of PD-307243 on the rapid component of delayed rectifier K(+) current (I(Kr)) in rabbit ventricular myocytes were similar to those observed in hERG channel-transfected CHO cells. Inside-out patch experiments revealed that PD-307243 increased hERG tail currents by 2.1 +/- 0.6 (n = 7) and 3.4 +/- 0.3-fold (n = 4) at 3 and 10 muM, respectively, by slowing the channel deactivation but had no effect on channel activation. During a voltage-clamp protocol using a prerecorded cardiac action potential, 3 muM PD-307243 increased the total potassium ions passed through hERG channels by 8.8 +/- 1.0-fold (n = 5). Docking studies suggest that PD-307243 interacts with residues in the S5-P region of the channel.
Defects in the trafficking of subunits encoded by the human ether-a-go-go-related gene (hERG1) can lead to catastrophic arrhythmias and sudden cardiac death due to a reduction in I(Kr)-mediated repolarization. Native I(Kr) channels are composed of two alpha subunits, hERG 1a and 1b. In heterologous expression systems, hERG 1b subunits efficiently produce current only in heteromeric combination with hERG 1a. We used Western blot analysis and electrophysiological recordings in HEK-293 cells and Xenopus oocytes to monitor hERG 1b maturation in the secretory pathway and to determine the factors regulating surface expression of hERG 1b subunits. We found that 1b subunits expressed alone were largely retained in the endoplasmic reticulum (ER), thus accounting for the poor functional expression of homomeric 1b currents. Association with hERG 1a facilitated 1b ER export and surface expression. We show that hERG 1b subunits fail to mature because of an "RXR" ER retention signal specific to the 1b N terminus of the human sequence and not conserved in other species. Mutating the RXR facilitated maturation and functional expression of homomeric hERG 1b channels in a charge-dependent manner. Co-expression of the 1b RXR mutants with hERG 1a did not further enhance 1b maturation, suggesting that hERG 1a promotes 1b trafficking by overcoming the RXR-mediated retention. Thus, selective trafficking mechanisms regulate subunit composition of surface hERG channels.
AIMS: Atrial fibrillation (AF) is the most frequent arrhythmia in humans. Rare familial forms exist. Recent evidence indicates a genetic susceptibility to common forms of AF. The alpha-subunit of the myocardial I(Kr)-channel, encoded by the KCNH2 gene, is crucial to ventricular and atrial repolarization. Patients with mutations in KCNH2 present with higher incidence of AF. Common variants in KCNH2 have been shown to modify ventricular repolarization. We intended to investigate, whether such variants may also modulate atrial repolarization and predispose to AF. METHODS AND RESULTS: In a two-stage association study we analysed 1207 AF-cases and 2475 controls. In stage I 40 tagSNPs (single nucleotide polymorphisms) from the KCNH2 genomic region were genotyped in 671 AF-cases and 694 controls. Of five associated variants, the common K897-allele of the KCNH2-K897T variant was replicated in n = 536 independent AF cases and n = 1781 controls in stage II [overall odds ratio 1.25, 95% confidence interval 1.11-1.41, P = 0.00033]. This association remained significant after adjustment for gender and age. CONCLUSION: We report a genetic association finding including positive replication between the K897-allele and higher incidence of AF. This provides a molecular correlate for complex genetic predispositions to AF. The consequences of the K897T variant at the atrial level will require further functional investigations.
We have recently identified a missense mutation, G604S, in the human ether-a-go-go related gene (hERG) that results in a malignant phenotype in a full pedigree of a Chinese congenital long QT syndrome (LQTS) family. The present study characterized the pathophysiological consequences of the mutation at the cellular level. Mutant G604S-hERG channels were expressed in HEK293 cells using a lipofectamine method. hERG currents were recorded using the voltage clamp technique. The expression of hERG protein was detected by Western blotting, and the subcellular location of hERG channels in cell was analyzed by confocal microscopy. We found that the G604S mutation did not lead to any expression of detectable currents, which was consistent with Western blotting analysis that the G604S-hERG mutation only expressed a band at 135 kDa. When coexpressed with wild-type (WT)-hERG, G604S-hERG exhibited strong dominant-negative current suppression resulting in decreased current density and altered gating properties of the WT-hERG channel, as well as interference with the trafficking of WT-hERG channel protein. In addition, confocal microscopy demonstrated that G604S-hERG subunits could be inserted into the cell membrane when forming heteromultimeric channels with WT-hERG channel subunits. Our results suggest that G604S mutation causes a loss of function in hERG through a strong dominant-negative effect on WT-hERG channel function that caused by impaired trafficking of WT-hERG channels, and further accentuates this suppression by forming heteromultimeric functional channels with WT-hERG subunits.
HERG1 K(+) channels are critical for modulating the duration of the cardiac action potential. The role of hERG1 channels in maintaining electrical stability in the heart derives from their unusual gating properties: slow activation and fast inactivation. HERG1 channel inactivation is intrinsically voltage sensitive and is not coupled to activation in the same way as in the Shaker family of K(+) channels. We recently proposed that the S4 transmembrane domain functions as the primary voltage sensor for hERG1 activation and inactivation and that distinct regions of S4 contribute to each gating process. In this study, we tested the hypothesis that S4 rearrangements underlying activation and inactivation gating may be associated with distinct cooperative interactions between a key residue in the S4 domain (R531) and acidic residues in neighboring regions (S1 - S3 domains) of the voltage sensing module. Using double-mutant cycle analysis, we found that R531 was energetically coupled to all acidic residues in S1-S3 during activation, but was coupled only to acidic residues near the extracellular portion of S2 and S3 (D456, D460 and D509) during inactivation. We propose that hERG1 activation involves a cooperative conformational change involving the entire voltage sensing module, while inactivation may involve a more limited interaction between R531 and D456, D460 and D509.
The long QT syndrome genes human ether-a-go-go-related gene (HERG1) and voltage-gated K+ channel, KQT-like subfamily, member 1, gene (KCNQ1), encoding K+ channels critical to the repolarization rate and repolarization reserve in cardiac cells, and thereby the likelihood of arrhythmias, are both composed of two isoforms: HERG1a and HERG1b and KCNQ1a and KCNQ1b, respectively. Expression of these genes is dynamic, depending on the differentiation status and disease states. We identified their core promoter regions and transcription start sites. Our data suggest that HERG1a and HERG1b, and KCNQ1a and KCNQ1b, represent independent transcripts instead of being alternatively spliced variants of the same gene, for they each have their own transcription start sites and their own promoter regions. We obtained data pointing to the potential role of stimulating protein 1 (Sp1) in the transactivation of these genes. We compared expression profiling of these genes across a variety of human tissues. Consistent with the general lack of cis elements for cardiac-specific transcription factors and the presence of multiple sites for ubiquitous Sp1 sites in the core promoter regions of HERG1a/HERG1b and KCNQ1a/KCNQ1b genes, the transcripts demonstrated widespread distribution across a variety of human tissues. We further revealed that the mRNA levels of all HERG1 and KCNQ1 isoforms were asymmetrically distributed within the heart, being more abundant in the right atria and ventricles relative to the left atria and ventricles. These findings open up an opportunity for studying interventricular gradients of slow and rapid delayed rectifier K+ current and of cardiac repolarization as well. Our study might help us understand the molecular mechanisms for arrhythmias since heterogeneity of ion channel activities is an important substrate for arrhythmogenesis.
Mutations in the human ether-a-go-go-related gene (hERG) cause type 2 long QT syndrome. In this study, we investigated the pathogenic mechanism of the hERG splice site mutation 2398+1G>C and the genotype-phenotype relationship of mutation carriers in three unrelated kindreds with long QT syndrome. The effect of 2398+1G>C on mRNA splicing was studied by analysis of RNA isolated from lymphocytes of index patients and using minigenes expressed in HEK293 cells and neonatal rat ventricular myocytes. RT-PCR analysis revealed that the 2398+1G>C mutation disrupted the normal splicing and activated a cryptic splice donor site in intron 9, leading to the inclusion of 54 nt of the intron 9 sequence in hERG mRNA. The cryptic splicing resulted in an in-frame insertion of 18 amino acids in the middle of the cyclic nucleotide binding domain. In patch clamp experiments the splice mutant did not generate hERG current. Western blot and immunostaining studies showed that the mutant expressed an immature form of hERG protein that failed to reach the plasma membrane. Coexpression of the mutant and wild-type channels led to a dominant negative suppression of wild-type channel function by intracellular retention of heteromeric channels. Our results demonstrate that 2398+1G>C activates a cryptic site and generates a full-length hERG protein with an insertion of 18 amino acids, which leads to a trafficking defect of the mutant channel.
BACKGROUND: Droperidol has a central antiemetic action and is widely used in the fields of psychiatry, anesthesia, and emergency medicine. It has been associated with prolongation of the QT interval of the electrocardiogram, and it may also be associated with torsades de pointes and sudden death. Although QT prolongation is consistent with droperidol-induced increases in cardiac ventricular action potential duration, the cellular mechanism for these observations has not been clearly studied. The rapidly activating delayed rectifier potassium channel, IKr, is a primary site of action of drugs causing QT prolongation and is encoded by the human-ether-a-go-go-related gene (HERG). To determine the mechanism underlying these clinical findings, we investigated the effect of droperidol on human HERG potassium channels. METHODS: Wild type and mutant HERG channels were heterologously expressed in human embryonic kidney 293 cells, and the current was recorded by using whole cell patch clamp technique (22-24 degrees C). RESULTS: HERG tail currents following test pulses to 50 mV were inhibited by droperidol with an IC(50) of 77.3 +/- 9.6 nM (n = 8). The onset of block was fast and inhibition was completely reversible upon washout. Droperidol affected HERG channels mainly in their open and inactivated states. The effects were use-dependent with a stronger steady-state level of block at higher frequencies. The activation curve was slightly shifted towards more negative potentials (P < 0.05, n = 8) and the time course of inactivation was significantly decreased (P < 0.05, n = 8) by 100 nM droperidol. But there was no relevant effect on HERG channel deactivation. The potency for block of HERG channels by droperidol was significantly decreased with mutation of Phe-656 to Thr or mutation of Ser-631 to Ala, respectively. However, mutation of Phe-656 to Met or the double mutation F656M/S631A had no effect on channel sensitivity to block by droperidol. CONCLUSIONS: Droperidol potently inhibits transfected HERG channels and this is the probable mechanism for QT prolongation. Channel blockade shows greatest affinity for the open and inactivated state. Aromatic residue at position 656 may participate in droperidol binding, and inactivation gating can induce a conformational state that optimizes droperidol binding to the channel.
A number of clinically used drugs block delayed rectifier K+ channels and prolong the duration of cardiac action potentials associated with long QT syndrome. This study investigated the molecular mechanisms of voltage-dependent inhibition of human ether-a-go-go-related gene (HERG) delayed rectifier K+ channels expressed in HEK-293 cells by brompheniramine, an antihistamine. Brompheniramine inhibited HERG current in a concentration-dependent manner with the half-maximal inhibitory concentration (IC50) value of 1.7 microm at 0 mV. A block of HERG current by brompheniramine was enhanced by progressive membrane depolarization and showed significantly negative shift in voltage-dependence of channel activation. Inhibition of HERG current by brompheniramine showed time-dependence. The S6 residue HERG mutant Y652A and F656C largely reduced the blocking potency of HERG current. These results indicate that brompheniramine mainly inhibited the HERG potassium channel through the residue Y652 and F656 and these residues may be an obligatory determinant in inhibition of HERG current for brompheniramine.
Activators of human ether-a-go-go-related gene 1 (hERG1) channels, such as (3R,4R)-4-[3-(6-methoxy-quinolin-4-yl)-3-oxo-propyl]-1-[3-(2,3,5-trifluoro-phenyl )-prop-2-ynyl]-piperidine-3-carboxylic acid (RPR260243), reverse the effect of hERG1 blockers and shorten the duration of cardiac action potentials. RPR260243 (RPR) slows the rate of deactivation and shifts the voltage dependence of channel inactivation to more positive potentials. We recently mapped the binding site for RPR to several residues located near the cytoplasmic ends of the S5 and S6 helices of the hERG1 subunit. These residues are conserved in the highly homologous ether-a-go-go-related gene 3 (ERG3) subunit; however, RPR blocks ERG3 channels. Here, we compare hERG1 and rat ERG3 (rERG3) channels to explore the molecular basis for differential channel sensitivity to RPR. Channels were heterologously expressed in Xenopus laevis oocytes, and currents were recorded using the two-electrode voltage-clamp technique. Site-directed mutagenesis was used to swap the two residues within the putative binding domain that differed between hERG1 and rERG3. The differential sensitivity of hERG1 and rERG3 channels to the agonist effect of RPR could be accounted for by a single S5 residue (Thr556 in hERG1, Ile558 in rERG3). A Thr in this position favors agonist activity, whereas an Ile reveals a secondary blocking effect of RPR.
Single-nucleotide polymorphisms (SNPs) in the human ether-a-go-go-related gene 1, hERG1, are associated with cardiac arrhythmias. The Kv11.1 channels encoded by hERG1 are also essential for rhythmic excitability of the pituitary, where they are regulated by thyroid hormone through a signal transduction cascade involving the phosphatidylinositol 3-kinase (PI3K) and the Ser/Thr-directed protein phosphatase, PP5. Here, we show that the hERG1 polymorphism at codon 897, which is read as a Thr instead of a Lys, creates a phosphorylation site for the Akt protein kinase on the Kv11.1 channel protein. Consequently, hormonal signaling through the PI3K signaling cascade, which normally stimulates K897 channels through PP5-mediated dephosphorylation, inhibits T897 channels through Akt-mediated phosphorylation. Thus, hormonal regulation of Kv11.1 in humans with the T897 polymorphism is predicted to prolong the QT interval of cardiac myocytes. A systematic bioinformatics search for SNPs in human ion channel genes identified 15 additional candidates for such "phosphorylopathies," which are predicted to create or destroy putative phosphorylation sites. Changes in protein phosphorylation might represent a general mechanism for the interaction of genetic variation and environment on human health.
Drug-induced torsades de pointes (TdP) arrhythmia is a major safety concern in the process of drug design and development. The incidence of TdP tends to be low, so early pre-clinical screens rely on surrogate markers of TdP to highlight potential problems with new drugs. hERG (human ether-a-go-go-related gene, alternative nomenclature KCNH2) is responsible for channels mediating the 'rapid' delayed rectifier K+ current (IKr) which plays an important role in ventricular repolarization. Pharmacological inhibition of native IKr and of recombinant hERG channels is a shared feature of diverse drugs associated with TdP. In vitro hERG assays therefore form a key element of an integrated assessment of TdP liability, with patch-clamp electrophysiology offering a 'gold standard'. However, whilst clearly necessary, hERG assays cannot be assumed automatically to provide sufficient information, when considered in isolation, to differentiate 'safe' from 'dangerous' drugs. Other relevant factors include therapeutic plasma concentration, drug metabolism and active metabolites, severity of target condition and drug effects on other cardiac ion channels that may mitigate or exacerbate effects of hERG blockade. Increased understanding of the nature of drug-hERG channel interactions may ultimately help eliminate potential hERG blockade early in the design and development process. Currently, for promising drug candidates integration of data from hERG assays with information from other pre-clinical safety screens remains essential.
Previous studies suggest that reactive oxygen species (ROS) play an important role in physiological responses to hypoxia. In the present study, we examined the effects of hypoxia on human ether-a-go-go related gene (hERG) channel protein expression and assessed the role of ROS. Hypoxia, in a stimulus- and time-dependent manner, decreased hERG protein with marked reduction in hERG K+ conductance in human embryonic kidney cells stably expressing the hERG alpha subunit. Down-regulation of hERG by hypoxia was not due to increased proteasomal degradation or decreased transcription but due to decreased synthesis of the protein. Hypoxia increased ROS in a time-dependent manner. Antioxidants prevented hypoxia-evoked down-regulation of hERG protein and exogenous oxidants mimicked the effects of hypoxia. Hypoxia-evoked down-regulation of hERG protein and elevation in ROS were absent in p(O) cells, which are devoid of mitochondrial DNA. Inhibitors of NADPH oxidase failed to prevent the effects of hypoxia. These results demonstrate that hypoxia enhances the production of ROS in the mitochondria, resulting in down-regulation of hERG translation and decreased hERG-mediated K+ conductance.
Resource Links
Contents
- Gene Summary
- Orthologs and Paralogs
- Antibodies
- Exon, Intron and UTRs
- CpG near TSS
- Gene Classification
- RefSeq Isoforms
- MicroRNA and Targets
- Transcript Sequences
- Protein Sequences
- Mutations and SNPs
- Phenotypes
- Chemicals and Drugs
- Gene and Diseases
- Gene Interactions
- Transcript Cluster
- Selected Publications

