KCNH2 | GeneID:3757 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 3757 Official Symbol KCNH2
Locus N/A Gene Type protein-coding
Synonyms ERG1; HERG; HERG1; Kv11.1; LQT2; SQT1
Full Name potassium voltage-gated channel, subfamily H (eag-related), member 2
Description potassium voltage-gated channel, subfamily H (eag-related), member 2
Chromosome 7q35-q36
Also Known As ether-a-go-go-related potassium channel protein; voltage-gated potassium channel, subfamily H, member 2
Summary This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 201

ID Symbol Protein Species
GeneID:3757 KCNH2 NP_000229.1 Homo sapiens
GeneID:16511 Kcnh2 NP_038597.1 Mus musculus
GeneID:117018 Kcnh2 NP_446401.1 Rattus norvegicus
GeneID:403761 KCNH2 NP_001003145.1 Canis lupus familiaris
GeneID:463894 KCNH2 XP_001137384.1 Pan troglodytes
GeneID:539971 KCNH2 XP_590603.3 Bos taurus
GeneID:100150957 LOC100150957 XP_001918581.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab53593 KCNH2 antibody - Carboxyterminal end (ab53593); Rabbit polyclonal to KCNH2 - Carboxyterminal end
2 abcam ab53590 KCNH2 antibody (ab53590); Rabbit polyclonal to KCNH2
3 acris AP18083PU-N KCNH2 (Center); antibody Ab
4 scbt KCNH2 KCNH2 Antibody / KCNH2 Antibodies;
5 sigma P0749 Anti-Potassium Channel Kv11.1 Extracellular antibody produced in rabbit ;
6 sigma P9497 Anti-Potassium Channel hKv11.1 antibody produced in rabbit ;
7 sigma K0640 Anti-Potassium Channel Kv11.1 (HERG) Extracellular−FITC antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of KCNH2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of KCNH2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0008076 Component voltage-gated potassium channel complex
GO:0005251 Function delayed rectifier potassium channel activity
GO:0030955 Function potassium ion binding
GO:0000155 Function two-component sensor activity
GO:0005244 Function voltage-gated ion channel activity
GO:0008015 Process blood circulation
GO:0006811 Process ion transport
GO:0006936 Process muscle contraction
GO:0006813 Process potassium ion transport
GO:0008016 Process regulation of heart contraction
GO:0006355 Process regulation of transcription, DNA-dependent
GO:0007605 Process sensory perception of sound
GO:0000160 Process two-component signal transduction system (phosphorelay)

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000238  UCSC Browser NP_000229 A5H1P7   Q12809  
2 NM_172056  UCSC Browser NP_742053
3 NM_172057  UCSC Browser NP_742054

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000262186 MI0000443 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000262186 MI0000444 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000262186 MI0000445 hsa-miR-124* CGUGUUCACAGCGGACCUUGAU
ENST00000262186 MI0000471 hsa-miR-126* CAUUAUUACUUUUGGUACGCG
ENST00000262186 MI0000252 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000262186 MI0000473 hsa-miR-129-5p CUUUUUGCGGUCUGGGCUUGC
ENST00000262186 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000262186 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000262186 MI0000732 hsa-miR-194* CCAGUGGGGCUGCUGUUAUCUG
ENST00000262186 MI0000747 hsa-miR-296-3p GAGGGUUGGGUGGAGGCUCUCC
ENST00000262186 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000262186 MI0000772 hsa-miR-302b* ACUUUAACAUGGAAGUGCUUUC
ENST00000262186 MI0000774 hsa-miR-302d* ACUUUAACAUGGAGGCACUUGC
ENST00000262186 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENST00000262186 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000262186 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000262186 MI0000804 hsa-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENST00000262186 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000262186 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENST00000262186 MI0000742 hsa-miR-34b* UAGGCAGUGUCAUUAGCUGAUUG
ENST00000262186 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000262186 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000262186 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000262186 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000262186 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000262186 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000262186 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000262186 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000262186 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000262186 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000262186 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000262186 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENST00000262186 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000262186 MI0003516 hsa-miR-545* UCAGUAAAUGUUUAUUAGAUGA
ENST00000262186 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000262186 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000262186 MI0003572 hsa-miR-566 GGGCGCCUGUGAUCCCAAC
ENST00000262186 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000262186 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000262186 MI0003610 hsa-miR-598 UACGUCAUCGUUGUCAUCGUCA
ENST00000262186 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENST00000262186 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000262186 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000262186 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENST00000262186 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENST00000262186 MI0005543 hsa-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENST00000262186 MI0005527 hsa-miR-886-3p CGCGGGUGCUUACUGACCCUU
ENST00000262186 MI0005712 hsa-miR-920 GGGGAGCUGUGGAAGCAGUA
ENST00000262186 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENST00000262186 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000262186 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000262186 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENST00000262186 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000262186 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000262186 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000262186 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000262186 MI0004601 mmu-miR-673-3p UCCGGGGCUGAGUUCUGUGCACC
ENST00000262186 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENST00000262186 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENST00000262186 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG
ENST00000262186 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000262186 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENST00000262186 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENST00000262186 MI0000636 rno-miR-349 CAGCCCUGCUGUCUUAACCUCU
ENST00000262186 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Amsacrine
  • Amsacrine binds to and results in decreased activity of KCNH2 protein
15148258
Arsenic
  • Arsenic affects the expression of KCNH2 mRNA
18414638
arsenic trioxide
  • arsenic trioxide results in increased expression of KCNH2 mRNA
15070760
arsenic trioxide
  • arsenic trioxide results in decreased localization of KCNH2 protein
15213294
Carmustine
  • Carmustine results in decreased expression of KCNH2 mRNA
15980968
Doxorubicin
  • Erythromycin affects the reaction [KCNH2 protein results in chemical resistance to Doxorubicin]
  • KCNH2 protein results in chemical resistance to Doxorubicin
16086867
Erythromycin
  • Erythromycin affects the reaction [KCNH2 protein results in chemical resistance to Doxorubicin]
16086867
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of KCNH2 mRNA
17555576
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of KCNH2 mRNA
17557909
Flavonoids
  • Flavonoids results in increased expression of KCNH2 mRNA
18035473
gabapentin
  • gabapentin results in decreased activity of KCNH2 protein
15716081
ginsenoside Rb1
  • ginsenoside Rb1 affects the activity of KCNH2 protein
15842772
ginsenoside Re
  • ginsenoside Re does not affect the activity of KCNH2 protein
15842772
ginsenoside Rf
  • ginsenoside Rf affects the activity of KCNH2 protein
15842772
ginsenoside Rg1
  • ginsenoside Rg1 affects the activity of KCNH2 protein
15842772
lamotrigine
  • lamotrigine results in decreased activity of KCNH2 protein
15716081
Mercury
  • Mercury results in increased expression of KCNH2 mRNA
16823088
panaxadiol
  • panaxadiol affects the activity of KCNH2 protein
15842772
panaxatriol
  • panaxatriol affects the activity of KCNH2 protein
15842772
Pentamidine
  • Pentamidine affects the localization of and affects the activity of KCNH2 protein
15340016
Saponins
  • Saponins affects the activity of KCNH2 protein
15842772
Tamoxifen
  • Tamoxifen affects the expression of KCNH2 mRNA
17555576
topiramate
  • topiramate results in decreased activity of KCNH2 protein
15716081

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Colonic Neoplasms marker 16086867
Long QT Syndrome marker 15213294
SHORT QT SYNDROME 1 marker
Torsades de Pointes marker 15213294
Diabetes Mellitus, Type 2 inferred via topiramate 16979414
Migraine Disorders inferred via topiramate 18765137, 18803445, 18759728
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 17049068, 15668708, 17893378, 17440819, 17261762, 16873071, 16818667, 11161223, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Leishmaniasis inferred via Pentamidine 15340016
Pneumonia, Pneumocystis inferred via Pentamidine 15340016
Trypanosomiasis inferred via Pentamidine 15340016
Autoimmune Diseases inferred via Mercury 16634805
Epilepsies, Partial inferred via lamotrigine 17116037
Migraine Disorders inferred via gabapentin 18803445, 18759728
Inflammation inferred via Flavonoids 17296493
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 16105132, 17333356, 17681005, 15861022, 11677210
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 17369602, 16935488, 18382427, 15136595, 11325840, 16322301, 16096432, 15993339, 18628466, 16826403, 17983394, 17426702
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 17876044, 16023760, 16234567
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17007740, 17974986, 17382496, 17308081, 15811867, 16731534, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16144979, 16879835, 16330681, 16244372, 16244371
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 15749863, 18437689, 16888761, 16729912, 16868541
Sarcoma inferred via Doxorubicin 18313854, 17710206, 15625365, 15675481, 17203757, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 15625365, 17203757
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Brain Neoplasms inferred via Carmustine 16187019
Glioblastoma inferred via Carmustine 16187019
Melanoma inferred via Carmustine 12393984
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 15073043, 14691202, 15553829, 11135700
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 17050201, 16968895
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 15622746, 16823087, 16330433, 16966277, 11161223, 16331271, 17217047, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182, 12712474
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 11468182, 14977855
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 12845720, 11780464
Arsenic Poisoning inferred via Arsenic 16251483, 12569548, 16835338
Atherosclerosis inferred via Arsenic 12928151
Carcinoma, Basal Cell inferred via Arsenic 15504454
Carcinoma, Hepatocellular inferred via Arsenic 16507464
Carcinoma, Squamous Cell inferred via Arsenic 15504454
Cardiovascular Diseases inferred via Arsenic 15738583
Carotid Artery Diseases inferred via Arsenic 16973168
Foot Diseases inferred via Arsenic 6392382
Hypertension inferred via Arsenic 9931084, 11953799
Keratosis inferred via Arsenic 17050553, 16930632, 12749816
Leukemia, Promyelocytic, Acute inferred via Arsenic 17339181
Liver Diseases inferred via Arsenic 11134558
Liver Neoplasms inferred via Arsenic 16368122
Myocardial Ischemia inferred via Arsenic 15371236
Neural Tube Defects inferred via Arsenic 16620997
Neurogenic Inflammation inferred via Arsenic 17056641
Peripheral Vascular Diseases inferred via Arsenic 15371236, 6392382, 16905509
Prostatic Neoplasms inferred via Arsenic 16140617
Skin Diseases inferred via Arsenic 17050553, 15952646, 16353154, 16759981, 6392382
Skin Neoplasms inferred via Arsenic 16251483, 17050553, 17029826, 15504454
Urinary Bladder Neoplasms inferred via Arsenic 15987713, 11144890
Vascular Diseases inferred via Arsenic 17056641
Herpes Simplex inferred via Amsacrine 10809021
Leukemia, Myeloid, Acute inferred via Amsacrine 18043129, 15148258

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
HRPT2 KCNH2 / HRPT2 Two-hybrid Stelzl U (2005)
KCNE1 KCNE1 / KCNH2 Invitro McDonald TV (1997)
KCR1 KCR1 / KCNH2 Affinity Capture-Western Kupershmidt S (2003)
NDUFS6 KCNH2 / NDUFS6 Two-hybrid Stelzl U (2005)
YWHAE KCNH2 / YWHAE Affinity Capture-Western Kagan A (2002)
YWHAE YWHAE / KCNH2 Reconstituted Complex Kagan A (2002)
YWHAE YWHAE / KCNH2 Two-hybrid Kagan A (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Chen J, et al. (2009) "PKA phosphorylation of HERG protein regulates the rate of channel synthesis." Am J Physiol Heart Circ Physiol. 296(5):H1244-H1254. PMID:19234087
  2. [ + ] Newton-Cheh C, et al. (2009) "Common variants at ten loci influence QT interval duration in the QTGEN Study." Nat Genet. 41(4):399-406. PMID:19305408
  3. [ + ] Millat G, et al. (2009) "Contribution of long-QT syndrome genetic variants in sudden infant death syndrome." Pediatr Cardiol. 30(4):502-509. PMID:19322600
  4. [ + ] Lehtinen AB, et al. (2009) "Relationship between genetic variants in myocardial sodium and potassium channel genes and QT interval duration in diabetics: the Diabetes Heart Study." Ann Noninvasive Electrocardiol. 14(1):72-79. PMID:19149796
  5. [ + ] Al-Owais M, et al. (2009) "Role of intracellular domains in the function of the herg potassium channel." Eur Biophys J. 38(5):569-576. PMID:19172259
  6. [ + ] Pfeufer A, et al. (2009) "Common variants at ten loci modulate the QT interval duration in the QTSCD Study." Nat Genet. 41(4):407-414. PMID:19305409
  7. [ + ] Huffaker SJ, et al. (2009) "A primate-specific, brain isoform of KCNH2 affects cortical physiology, cognition, neuronal repolarization and risk of schizophrenia." Nat Med. 15(5):509-518. PMID:19412172
  8. [ + ] Marjamaa A, et al. (2009) "High prevalence of four long QT syndrome founder mutations in the Finnish population." Ann Med. 41(3):234-240. PMID:19160088
  9. [ + ] Delisle BP, et al. (2009) "Small GTPase determinants for the Golgi processing and plasmalemmal expression of human ether-a-go-go related (hERG) K+ channels." J Biol Chem. 284(5):2844-2853. PMID:19029296
  10. [ + ] Ganapathi SB, et al. (2009) "State-dependent block of HERG potassium channels by R-roscovitine: implications for cancer therapy." Am J Physiol Cell Physiol. 296(4):C701-C710. PMID:19244476
  11. [ + ] Marjamaa A, et al. (2009) "Common candidate gene variants are associated with QT interval duration in the general population." J Intern Med. 265(4):448-458. PMID:19019189
  12. [ + ] Nagaoka I, et al. (2008) "Mutation site dependent variability of cardiac events in Japanese LQT2 form of congenital long-QT syndrome." Circ J. 72(5):694-699. PMID:18441445
  13. [ + ] Larsen AP, et al. (2008) "Characterization of hERG1a and hERG1b potassium channels-a possible role for hERG1b in the I (Kr) current." Pflugers Arch. 456(6):1137-1148. PMID:18504605
  14. [ + ] Inanobe A, et al. (2008) "In silico prediction of the chemical block of human ether-a-go-go-related gene (hERG) K+ current." J Physiol Sci. 58(7):459-470. PMID:19032804
  15. [ + ] Kamiya K, et al. (2008) "Molecular determinants of hERG channel block by terfenadine and cisapride." J Pharmacol Sci. 108(3):301-307. PMID:18987434
  16. [ + ] Zhang X, et al. (2008) "Protective effect of KCNH2 single nucleotide polymorphism K897T in LQTS families and identification of novel KCNQ1 and KCNH2 mutations." BMC Med Genet. 9():87. PMID:18808722
  17. [ + ] Lin J, et al. (2008) "The regulation of the cardiac potassium channel (HERG) by caveolin-1." Biochem Cell Biol. 86(5):405-415. PMID:18923542
  18. [ + ] Deisemann H, et al. (2008) "Effects of common antitussive drugs on the hERG potassium channel current." J Cardiovasc Pharmacol. 52(6):494-499. PMID:19034038
  19. [ + ] Berge KE, et al. (2008) "Molecular genetic analysis of long QT syndrome in Norway indicating a high prevalence of heterozygous mutation carriers." Scand J Clin Lab Invest. 68(5):362-368. PMID:18752142
  20. [ + ] Bhuiyan ZA, et al. (2008) "Recurrent intrauterine fetal loss due to near absence of HERG: clinical and functional characterization of a homozygous nonsense HERG Q1070X mutation." Heart Rhythm. 5(4):553-561. PMID:18362022
  21. [ + ] Eddy CA, et al. (2008) "Identification of large gene deletions and duplications in KCNQ1 and KCNH2 in patients with long QT syndrome." Heart Rhythm. 5(9):1275-1281. PMID:18774102
  22. [ + ] Amin AS, et al. (2008) "Fever-induced QTc prolongation and ventricular arrhythmias in individuals with type 2 congenital long QT syndrome." J Clin Invest. 118(7):2552-2561. PMID:18551196
  23. [ + ] Lin MT, et al. (2008) "In utero onset of long QT syndrome with atrioventricular block and spontaneous or lidocaine-induced ventricular tachycardia: compound effects of hERG pore region mutation and SCN5A N-terminus variant." Heart Rhythm. 5(11):1567-1574. PMID:18848812
  24. [ + ] Teng GQ, et al. (2008) "Homozygous missense N629D hERG (KCNH2) potassium channel mutation causes developmental defects in the right ventricle and its outflow tract and embryonic lethality." Circ Res. 103(12):1483-1491. PMID:18948620
  25. [ + ] Christe G, et al. (2008) "A new C-terminal hERG mutation A915fs+47X associated with symptomatic LQT2 and auditory-trigger syncope." Heart Rhythm. 5(11):1577-1586. PMID:18984536
  26. [ + ] Zhang Y, et al. (2008) "Single nucleotide polymorphisms and haplotype of four genes encoding cardiac ion channels in Chinese and their association with arrhythmia." Ann Noninvasive Electrocardiol. 13(2):180-190. PMID:18426444
  27. [ + ] Koskela J, et al. (2008) "Potassium channel KCNH2 K897T polymorphism and cardiac repolarization during exercise test: The Finnish Cardiovascular Study." Scand J Clin Lab Invest. 68(1):31-38. PMID:17852802
  28. [ + ] Biliczki P, et al. (2008) "Cellular properties of C-terminal KCNH2 long QT syndrome mutations: description and divergence from clinical phenotypes." Heart Rhythm. 5(8):1159-1167. PMID:18675227
  29. [ + ] Perrin MJ, et al. (2008) "Human ether-a-go-go related gene (hERG) K+ channels: function and dysfunction." Prog Biophys Mol Biol. 98(2-3):137-148. PMID:19027781
  30. [ + ] Miranda P, et al. (2008) "FRET with multiply labeled HERG K(+) channels as a reporter of the in vivo coarse architecture of the cytoplasmic domains." Biochim Biophys Acta. 1783(10):1681-1699. PMID:18634834
  31. [ + ] Lin J, et al. (2008) "The four and a half LIM domain protein 2 interacts with and regulates the HERG channel." FEBS J. 275(18):4531-4539. PMID:18680509
  32. [ + ] Sale H, et al. (2008) "Physiological properties of hERG 1a/1b heteromeric currents and a hERG 1b-specific mutation associated with Long-QT syndrome." Circ Res. 103(7):e81-e95. PMID:18776039
  33. [ + ] Otagiri T, et al. (2008) "Cardiac ion channel gene mutations in sudden infant death syndrome." Pediatr Res. 64(5):482-487. PMID:18596570
  34. [ + ] Wu ZY, et al. (2008) "Stimulation of N-terminal truncated isoform of androgen receptor stabilizes human ether-a-go-go-related gene-encoded potassium channel protein via activation of extracellular signal regulated kinase 1/2." Endocrinology. 149(10):5061-5069. PMID:18599551
  35. [ + ] Zhao J, et al. (2008) "Silencing of herg gene by shRNA inhibits SH-SY5Y cell growth in vitro and in vivo." Eur J Pharmacol. 579(1-3):50-57. PMID:17976575
  36. [ + ] Gordon E, et al. (2008) "2-[2-(3,4-dichloro-phenyl)-2,3-dihydro-1H-isoindol-5-ylamino]-nicotinic acid (PD-307243) causes instantaneous current through human ether-a-go-go-related gene potassium channels." Mol Pharmacol. 73(3):639-651. PMID:18042732
  37. [ + ] Phartiyal P, et al. (2008) "Endoplasmic reticulum retention and rescue by heteromeric assembly regulate human ERG 1a/1b surface channel composition." J Biol Chem. 283(7):3702-3707. PMID:18048364
  38. [ + ] Sinner MF, et al. (2008) "The non-synonymous coding IKr-channel variant KCNH2-K897T is associated with atrial fibrillation: results from a systematic candidate gene-based analysis of KCNH2 (HERG)." Eur Heart J. 29(7):907-914. PMID:18222980
  39. [ + ] Huo J, et al. (2008) "The G604S-hERG mutation alters the biophysical properties and exerts a dominant-negative effect on expression of hERG channels in HEK293 cells." Pflugers Arch. 456(5):917-928. PMID:18386051
  40. [ + ] Piper DR, et al. (2008) "Cooperative interactions between R531 and acidic residues in the voltage sensing module of hERG1 channels." Cell Physiol Biochem. 21(1-3):37-46. PMID:18209470
  41. [ + ] Luo X, et al. (2008) "Genomic structure, transcriptional control, and tissue distribution of HERG1 and KCNQ1 genes." Am J Physiol Heart Circ Physiol. 294(3):H1371-H1380. PMID:18192214
  42. [ + ] Black LA, et al. (2008) "Minimization of potential hERG liability in histamine H3 receptor antagonists." Inflamm Res. 57 Suppl 1():S45-S46. PMID:18345496
  43. [ + ] Gong Q, et al. (2008) "A splice site mutation in hERG leads to cryptic splicing in human long QT syndrome." J Mol Cell Cardiol. 44(3):502-509. PMID:18272172
  44. [ + ] Luo T, et al. (2008) "Inhibition of the HERG channel by droperidol depends on channel gating and involves the S6 residue F656." Anesth Analg. 106(4):1161-70, table of contents. PMID:18349188
  45. [ + ] Park SJ, et al. (2008) "Blockade of HERG K+ channel by an antihistamine drug brompheniramine requires the channel binding within the S6 residue Y652 and F656." J Appl Toxicol. 28(2):104-111. PMID:17516459
  46. [ + ] Perry M, et al. (2008) "A single amino acid difference between ether-a-go-go- related gene channel subtypes determines differential sensitivity to a small molecule activator." Mol Pharmacol. 73(4):1044-1051. PMID:18162604
  47. [ + ] Gentile S, et al. (2008) "The human ERG1 channel polymorphism, K897T, creates a phosphorylation site that inhibits channel activity." Proc Natl Acad Sci U S A. 105(38):14704-14708. PMID:18791070
  48. [ + ] Hancox JC, et al. (2008) "The hERG potassium channel and hERG screening for drug-induced torsades de pointes." Pharmacol Ther. 119(2):118-132. PMID:18616963
  49. [ + ] Nanduri J, et al. (2008) "Mitochondrial reactive oxygen species mediate hypoxic down-regulation of hERG channel protein." Biochem Biophys Res Commun. 373(2):309-314. PMID:18570888