ACADVL | GeneID:37 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 37 Official Symbol ACADVL
Locus N/A Gene Type protein-coding
Synonyms ACAD6; LCACD; VLCAD
Full Name acyl-Coenzyme A dehydrogenase, very long chain
Description acyl-Coenzyme A dehydrogenase, very long chain
Chromosome 17p13-p11
Also Known As
Summary The protein encoded by this gene is targeted to the inner mitochondrial membrane where it catalyzes the first step of the mitochondrial fatty acid beta-oxidation pathway. This acyl-Coenzyme A dehydrogenase is specific to long-chain and very-long-chain fatty acids. A deficiency in this gene product reduces myocardial fatty acid beta-oxidation and is associated with cardiomyopathy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5

ID Symbol Protein Species
GeneID:37 ACADVL NP_000009.1 Homo sapiens
GeneID:11370 Acadvl NP_059062.1 Mus musculus
GeneID:25363 Acadvl NP_037023.1 Rattus norvegicus
GeneID:37217 CG7461 NP_611409.1 Drosophila melanogaster
GeneID:174180 E04F6.5 NP_001022062.1 Caenorhabditis elegans
GeneID:282130 ACADVL NP_776919.1 Bos taurus
GeneID:489463 ACADVL XP_546581.2 Canis lupus familiaris
GeneID:573723 acadvl NP_997776.1 Danio rerio
GeneID:1275628 AgaP_ENSANGG00000009991 XP_314895.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab54698 ACADVL antibody (ab54698); Mouse monoclonal to ACADVL
2 abnova H00000037-M01 ACADVL monoclonal antibody (M01), clone 5D3; Mouse monoclonal antibody raised against a partial recombinant ACADVL.
3 acris AP17074PU-N ACADVL (N-term); antibody Ab
4 scbt ACADVL ACADVL Antibody / ACADVL Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACADVL Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACADVL Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0042645 Component mitochondrial nucleoid
GO:0005739 Component mitochondrion
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0004466 Function long-chain-acyl-CoA dehydrogenase activity
GO:0015980 Process energy derivation by oxidation of organic compounds
GO:0006635 Process fatty acid beta-oxidation
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000018  UCSC Browser NP_000009
2 NM_001033859  UCSC Browser NP_001029031

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000322910 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000322910 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000322910 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000322910 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000322910 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000322910 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000322910 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000322910 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000322910 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000322910 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000322910 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000322910 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000322910 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000322910 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENST00000322910 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000322910 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000322910 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000322910 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENST00000322910 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENST00000322910 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000322910 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000322910 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000322910 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000322910 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000322910 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000322910 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000322910 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000322910 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000322910 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000322910 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000322910 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000322910 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENST00000322910 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000322910 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENST00000322910 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000322910 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000322910 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000322910 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000322910 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000322910 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000322910 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000322910 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000322910 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000356839 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000356839 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000356839 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000356839 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000356839 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000356839 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000356839 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000356839 MI0000067 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000356839 MI0000068 hsa-let-7f UGAGGUAGUAGAUUGUAUAGUU
ENST00000356839 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000356839 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000356839 MI0000103 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000356839 MI0000739 hsa-miR-101 UACAGUACUGUGAUAACUGAA
ENST00000356839 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000356839 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000356839 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000356839 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000356839 MI0000474 hsa-miR-134 UGUGACUGGUUGACCAGAGGGG
ENST00000356839 MI0000479 hsa-miR-150* CUGGUACAGGCCUGGGGGACAG
ENST00000356839 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000356839 MI0000238 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000356839 MI0000279 hsa-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENST00000356839 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENST00000356839 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000356839 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000356839 MI0000290 hsa-miR-214 ACAGCAGGCACAGACAGGCAGU
ENST00000356839 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENST00000356839 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENST00000356839 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000356839 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000356839 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000356839 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000356839 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000356839 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000356839 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000356839 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000356839 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000356839 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000356839 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000356839 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000356839 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000356839 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000356839 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000356839 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000356839 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENST00000356839 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000356839 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENST00000356839 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENST00000356839 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000356839 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000356839 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000356839 MI0003560 hsa-miR-92b* AGGGACGGGACGCGGUGCAGUG
ENST00000356839 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000356839 MI0000100 hsa-miR-98 UGAGGUAGUAAGUUGUAUUGUU
ENST00000356839 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000356839 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000356839 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENST00000356839 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000356839 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000356839 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000356839 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENST00000356839 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENST00000356839 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENST00000356839 MI0004683 mmu-miR-699 AGGCAGUGCGACCUGGCUCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Dietary Fats
  • Dietary Fats results in increased expression of ACADVL mRNA
18042831, 16357043
Doxorubicin
  • Doxorubicin results in decreased expression of ACADVL protein
16144979
Fenretinide
  • Fenretinide results in increased expression of ACADVL mRNA
16671099
Flavonoids
  • Flavonoids results in decreased expression of ACADVL mRNA
18035473
palm oil
  • palm oil results in increased expression of ACADVL mRNA
18042831
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACADVL mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ACADVL mRNA
18301758, 17426115, 16357043
Zinc
  • Zinc results in increased expression of ACADVL mRNA
17074742
Zinc Sulfate
  • Zinc Sulfate results in increased expression of ACADVL mRNA
17074742

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ACYL-CoA DEHYDROGENASE, VERY LONG-CHAIN, DEFICIENCY OF marker
Hepatolenticular Degeneration inferred via Zinc Sulfate 17063115
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16325427, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16700911, 16606632
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Inflammation inferred via Flavonoids 17296493
Brain Neoplasms inferred via Fenretinide 16187019
Breast Neoplasms inferred via Fenretinide 16601279
Carcinoma, Hepatocellular inferred via Fenretinide 17159502, 16270382
Carcinoma, Squamous Cell inferred via Fenretinide 16274795
Cervical Intraepithelial Neoplasia inferred via Fenretinide 16154183
Colorectal Neoplasms inferred via Fenretinide 17273769
Glioblastoma inferred via Fenretinide 16187019
Leukoplakia, Oral inferred via Fenretinide 16707609
Melanoma inferred via Fenretinide 16270382
Mouth Neoplasms inferred via Fenretinide 16274795
Neoplasms inferred via Fenretinide 17353921, 15958647
Neuronal Ceroid-Lipofuscinoses inferred via Fenretinide 16303764
Ovarian Neoplasms inferred via Fenretinide 16133793
Pancreatic Neoplasms inferred via Fenretinide 15580305
Prostatic Neoplasms inferred via Fenretinide 17024972
Retinal Degeneration inferred via Fenretinide 16303925
Skin Neoplasms inferred via Fenretinide 16467112
Urinary Bladder Neoplasms inferred via Fenretinide 16720286
Uterine Cervical Neoplasms inferred via Fenretinide 16154183
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 17426702, 16826403, 18382427, 17369602, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 15136595, 11325840, 16935488, 18628466, 17983394, 15939500
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 17876044, 16234567, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17308081, 17382496, 17007740, 15811867, 17974986, 17329180, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 16731534
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16244372, 16244371, 16144979, 16330681, 16879835
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 18501091, 15147373
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 15749863, 18437689, 16729912, 16868541, 16888761
Sarcoma inferred via Doxorubicin 18313854, 17710206, 17203757, 15625365, 15675481, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACADVL ACADVL / ACADVL Co-purification Souri M (1998)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  2. [ + ] Soon PS, et al. (2008) "Loss of heterozygosity of 17p13, with possible involvement of ACADVL and ALOX15B, in the pathogenesis of adrenocortical tumors." Ann Surg. 247(1):157-164. PMID:18156936
  3. [ + ] Bogenhagen DF, et al. (2008) "The layered structure of human mitochondrial DNA nucleoids." J Biol Chem. 283(6):3665-3675. PMID:18063578
  4. [ + ] Spiekerkoetter U, et al. (2007) "Effects of a fat load and exercise on asymptomatic VLCAD deficiency." J Inherit Metab Dis. 30(3):405. PMID:17457695
  5. [ + ] Goetzman ES, et al. (2007) "Expression and characterization of mutations in human very long-chain acyl-CoA dehydrogenase using a prokaryotic system." Mol Genet Metab. 91(2):138-147. PMID:17374501
  6. [ + ] Gobin-Limballe S, et al. (2007) "Genetic basis for correction of very-long-chain acyl-coenzyme A dehydrogenase deficiency by bezafibrate in patient fibroblasts: toward a genotype-based therapy." Am J Hum Genet. 81(6):1133-1143. PMID:17999356
  7. [ + ] Zia A, et al. (2007) "Very long chain acyl-CoA dehydrogenase deficiency in a pair of mildly affected monozygotic twin sister in their late fifties." J Inherit Metab Dis. 30(5):817. PMID:17514507
  8. [ + ] Campbell CD, et al. (2005) "Two newborns with nutritional vitamin B12 deficiency: challenges in newborn screening for vitamin B12 deficiency." Haematologica. 90(12 Suppl):ECR45. PMID:16464760
  9. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  10. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  11. [ + ] Zhang LF, et al. (2003) "Characterization of the bidirectional promoter region between the human genes encoding VLCAD and PSD-95." Genomics. 82(6):660-668. PMID:14611808
  12. [ + ] Zhou C, et al. (2003) "Overlapping gene structure of human VLCAD and DLG4." Gene. 305(2):161-166. PMID:12609736
  13. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  14. [ + ] Fukao T, et al. (2001) "Myopathic form of very-long chain acyl-coa dehydrogenase deficiency: evidence for temperature-sensitive mild mutations in both mutant alleles in a Japanese girl." Pediatr Res. 49(2):227-231. PMID:11158518
  15. [ + ] Watanabe H, et al. (2000) "Molecular basis of very long chain acyl-CoA dehydrogenase deficiency in three Israeli patients: identification of a complex mutant allele with P65L and K247Q mutations, the former being an exonic mutation causing exon 3 skipping." Hum Mutat. 15(5):430-438. PMID:10790204
  16. [ + ] Andresen BS, et al. (1999) "Clear correlation of genotype with disease phenotype in very-long-chain acyl-CoA dehydrogenase deficiency." Am J Hum Genet. 64(2):479-494. PMID:9973285
  17. [ + ] Mathur A, et al. (1999) "Molecular heterogeneity in very-long-chain acyl-CoA dehydrogenase deficiency causing pediatric cardiomyopathy and sudden death." Circulation. 99(10):1337-1343. PMID:10077518
  18. [ + ] Souri M, et al. (1998) "Very-long-chain acyl-CoA dehydrogenase subunit assembles to the dimer form on mitochondrial inner membrane." FEBS Lett. 426(2):187-190. PMID:9599005
  19. [ + ] Cox GF, et al. (1998) "Reversal of severe hypertrophic cardiomyopathy and excellent neuropsychologic outcome in very-long-chain acyl-coenzyme A dehydrogenase deficiency." J Pediatr. 133(2):247-253. PMID:9709714
  20. [ + ] Smelt AH, et al. (1998) "Very long chain acyl-coenzyme A dehydrogenase deficiency with adult onset." Ann Neurol. 43(4):540-544. PMID:9546340
  21. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  22. [ + ] Andresen BS, et al. (1996) "Cloning and characterization of human very-long-chain acyl-CoA dehydrogenase cDNA, chromosomal assignment of the gene and identification in four patients of nine different mutations within the VLCAD gene." Hum Mol Genet. 5(4):461-472. PMID:8845838
  23. [ + ] Aoyama T, et al. (1996) "Assignment of the human mitochondrial very-long-chain acyl-CoA dehydrogenase gene (LCACD) to 17p13 by in situ hybridization." Genomics. 37(1):144-145. PMID:8921384
  24. [ + ] Souri M, et al. (1996) "Mutation analysis of very-long-chain acyl-coenzyme A dehydrogenase (VLCAD) deficiency: identification and characterization of mutant VLCAD cDNAs from four patients." Am J Hum Genet. 58(1):97-106. PMID:8554073
  25. [ + ] Aoyama T, et al. (1995) "Cloning of human very-long-chain acyl-coenzyme A dehydrogenase and molecular characterization of its deficiency in two patients." Am J Hum Genet. 57(2):273-283. PMID:7668252
  26. [ + ] Orii KO, et al. (1995) "Genomic DNA organization of human mitochondrial very-long-chain acyl-CoA dehydrogenase and mutation analysis." Biochem Biophys Res Commun. 217(3):987-992. PMID:8554625
  27. [ + ] Aoyama T, et al. (1995) "Purification of human very-long-chain acyl-coenzyme A dehydrogenase and characterization of its deficiency in seven patients." J Clin Invest. 95(6):2465-2473. PMID:7769092
  28. [ + ] Strauss AW, et al. (1995) "Molecular basis of human mitochondrial very-long-chain acyl-CoA dehydrogenase deficiency causing cardiomyopathy and sudden death in childhood." Proc Natl Acad Sci U S A. 92(23):10496-10500. PMID:7479827
  29. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298
  30. [ + ] Aoyama T, et al. (1993) "A novel disease with deficiency of mitochondrial very-long-chain acyl-CoA dehydrogenase." Biochem Biophys Res Commun. 191(3):1369-1372. PMID:8466512