acin1a | GeneID:368893 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 368893 Official Symbol acin1a
Locus zC14A17.12 Gene Type protein-coding
Synonyms acinus; acinusa; acinusl; ik:tdsubc_2g5; si:zc14a17.12; wu:fb04g06; wu:fb40f03; wu:fb68h03; wu:fb80f07; wu:fc12e10; xx:tdsubc_2g5
Full Name apoptotic chromatin condensation inducer 1a
Description apoptotic chromatin condensation inducer 1a
Chromosome N/A
Also Known As apoptotic chromatin condensation inducer in the nucleus, a; apoptotic chromatin condensation inducer in the nucleus-like; chromatin condensation inducer
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001007105 NP_001007106

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000076459 MI0001982 dre-miR-129 CUUUUUGCGGUCUGGGCUUGCU
ENSDART00000076459 MI0001983 dre-miR-129 CUUUUUGCGGUCUGGGCUUGCU
ENSDART00000076459 MI0002005 dre-miR-142a-5p CAUAAAGUAGAAAGCACUACU
ENSDART00000076459 MI0002006 dre-miR-142b-5p CAUAAAGUAGACAGCACUACUA
ENSDART00000076459 MI0001380 dre-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSDART00000076459 MI0003387 dre-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSDART00000076459 MI0001366 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000076459 MI0001367 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000076459 MI0002024 dre-miR-181c CACAUUCAUUGCUGUCGGUGGG
ENSDART00000076459 MI0001372 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000076459 MI0002035 dre-miR-196a UAGGUAGUUUCAUGUUGUUGGG
ENSDART00000076459 MI0002045 dre-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSDART00000076459 MI0002046 dre-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSDART00000076459 MI0001933 dre-miR-29b UAGCACCAUUUGAAAUCAGUGU
ENSDART00000076459 MI0001934 dre-miR-29b UAGCACCAUUUGAAAUCAGUGU
ENSDART00000076459 MI0001936 dre-miR-29b UAGCACCAUUUGAAAUCAGUGU
ENSDART00000076459 MI0002181 dre-miR-460-3p CACAGCGCAUACAAUGUGGAUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932