abcb3l1 | GeneID:368771 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 368771 Official Symbol abcb3l1
Locus CH211-51F10.7 Gene Type protein-coding
Synonyms TAP2; abcb3; si:dz179b20.1; si:dz262K18.3
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 3 like 1
Description ATP-binding cassette, sub-family B (MDR/TAP), member 3 like 1
Chromosome N/A
Also Known As TAP
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37323

ID Symbol Protein Species
GeneID:6891 TAP2 NP_000535.3 Homo sapiens
GeneID:21355 Tap2 NP_035660.2 Mus musculus
GeneID:24812 Tap2 NP_114445.1 Rattus norvegicus
GeneID:281586 TAP2 NP_776647.1 Bos taurus
GeneID:368771 abcb3l1 NP_001006594.1 Danio rerio
GeneID:474864 TAP2 XP_532099.2 Canis lupus familiaris
GeneID:556826 LOC556826 XP_682981.1 Danio rerio
GeneID:618733 TAP2 NP_001040087.1 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0046686 Process response to cadmium ion
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001006594 NP_001006594

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000031380 MI0001366 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG
ENSDART00000031380 MI0001367 dre-miR-181b AACAUUCAUUGCUGUCGGUGGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gonzalez P, et al. (2006) "Comparative effects of direct cadmium contamination on gene expression in gills, liver, skeletal muscles and brain of the zebrafish (Danio rerio)." Biometals. 19(3):225-235. PMID:16799861
  2. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856