abcc4 | GeneID:368620 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 368620 Official Symbol abcc4
Locus dZ52I16.4 Gene Type protein-coding
Synonyms MRP; cb1019; si:busm1-52i16.4; si:dz202l16.5; si:dz52i16.4
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 4
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74563

ID Symbol Protein Species
GeneID:10257 ABCC4 NP_005836.2 Homo sapiens
GeneID:35163 CG31792 NP_724148.1 Drosophila melanogaster
GeneID:47905 l(2)03659 NP_610482.2 Drosophila melanogaster
GeneID:170924 Abcc4 NP_596902.1 Rattus norvegicus
GeneID:180691 mrp-6 NP_508710.2 Caenorhabditis elegans
GeneID:239273 Abcc4 NP_001028508.1 Mus musculus
GeneID:368620 abcc4 NP_001007039.1 Danio rerio
GeneID:418791 ABCC4 NP_001025990.1 Gallus gallus
GeneID:452625 ABCC4 XP_001137006.1 Pan troglodytes
GeneID:485523 ABCC4 XP_542642.2 Canis lupus familiaris
GeneID:515333 ABCC4 XP_593336.2 Bos taurus
GeneID:820496 ATMRP3 NP_187915.1 Arabidopsis thaliana
GeneID:820497 ATMRP8 NP_187916.3 Arabidopsis thaliana
GeneID:820498 ATMRP7 NP_187917.3 Arabidopsis thaliana
GeneID:4327122 Os01g0173900 NP_001042159.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0005254 Function chloride channel activity
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0006811 Process ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001007038 NP_001007039

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000065500 MI0001966 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000065500 MI0001967 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000065500 MI0001968 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000065500 MI0001969 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000065500 MI0001970 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000065500 MI0001971 dre-miR-124 UAAGGCACGCGGUGAAUGCCAA
ENSDART00000065500 MI0002002 dre-miR-138 AGCUGGUGUUGUGAAUCAGGCC
ENSDART00000065500 MI0001370 dre-miR-187 UCGUGUCUUGUGUUGCAGCC
ENSDART00000065500 MI0001388 dre-miR-222 AGCUACAUCUGGCUACUGGGUCUC
ENSDART00000065500 MI0004769 dre-miR-725 UUCAGUCAUUGUUUCUAGUAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  3. [ + ] Lo J, et al. (2003) "15000 unique zebrafish EST clusters and their future use in microarray for profiling gene expression patterns during embryogenesis." Genome Res. 13(3):455-466. PMID:12618376