ABCC6 | GeneID:368 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 368 Official Symbol ABCC6
Locus N/A Gene Type protein-coding
Synonyms ABC34; ARA; EST349056; MLP1; MOATE; MRP6; PXE; PXE1
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Chromosome 16p13.1
Also Known As ATP-binding cassette, sub-family C, member 6; anthracycline resistance-associated protein
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). The encoded protein, a member of the MRP subfamily, is involved in multi-drug resistance. Mutations in this gene cause pseudoxanthoma elasticum. Alternatively spliced transcript variants that encode different proteins have been described for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55559

ID Symbol Protein Species
GeneID:368 ABCC6 NP_001162.3 Homo sapiens
GeneID:27421 Abcc6 NP_061265.1 Mus musculus
GeneID:81642 Abcc6 NP_112275.1 Rattus norvegicus
GeneID:416600 ABCC6 XP_001234744.1 Gallus gallus
GeneID:489993 ABCC6 XP_547113.2 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3381 MRP6 antibody [M6II-31] (ab3381); Rat monoclonal [M6II-31] to MRP6
2 abnova H00000368-M02 ABCC6 monoclonal antibody (M02), clone 5D8; Mouse monoclonal antibody raised against a partial recombinant ABCC6.
3 abnova H00000368-M01 ABCC6 monoclonal antibody (M01), clone 1E6; Mouse monoclonal antibody raised against a partial recombinant ABCC6.
4 scbt ABCC6 ABCC6 Antibody / ABCC6 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC6 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC6 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0042493 Process response to drug
GO:0050896 Process response to stimulus
GO:0006810 Process transport
GO:0007601 Process visual perception

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001079528  UCSC Browser NP_001072996
2 NM_001171  UCSC Browser NP_001162

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000205557 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000205557 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENST00000205557 MI0000294 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000205557 MI0000295 hsa-miR-218 UUGUGCUUGAUCUAACCAUGU
ENST00000205557 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENST00000205557 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000205557 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000205557 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENST00000205557 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000205557 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENST00000205557 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENST00000205557 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000205557 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000205557 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000205557 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000205557 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000205557 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000205557 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000205557 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000205557 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000205557 MI0003518 mmu-miR-540-5p CAAGGGUCACCCUCUGACUCUGU
ENST00000205557 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENST00000333763 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000333763 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000333763 MI0000111 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000333763 MI0000112 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000333763 MI0000267 hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU
ENST00000333763 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENST00000333763 MI0000446 hsa-miR-125b-1* ACGGGUUAGGCUCUUGGGAGCU
ENST00000333763 MI0000477 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENST00000333763 MI0003129 hsa-miR-146b-5p UGAGAACUGAAUUCCAUAGGCU
ENST00000333763 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000333763 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000333763 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000333763 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000333763 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000333763 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000333763 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000333763 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000333763 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000333763 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000333763 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000333763 MI0000296 hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG
ENST00000333763 MI0000296 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000333763 MI0000740 hsa-miR-219-5p UGAUUGUCCAAACGCAAUUCU
ENST00000333763 MI0000300 hsa-miR-223* CGUGUAUUUGACAAGCUGAGUU
ENST00000333763 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000333763 MI0000773 hsa-miR-302c* UUUAACAUGGGGGUACCUGCUG
ENST00000333763 MI0000736 hsa-miR-30c-1* CUGGGAGAGGGUUGUUUACUCC
ENST00000333763 MI0000254 hsa-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENST00000333763 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000333763 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000333763 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000333763 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000333763 MI0005566 hsa-miR-374b* CUUAGCAGGUUGUAUUAUCAUU
ENST00000333763 MI0000784 hsa-miR-376a* GUAGAUUCUCCUUCUAUGAGUA
ENST00000333763 MI0000776 hsa-miR-376c AACAUAGAGGAAAUUCCACGU
ENST00000333763 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000333763 MI0001637 hsa-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENST00000333763 MI0003123 hsa-miR-488 UUGAAAGGCUAUUUCUUGGUC
ENST00000333763 MI0003126 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG
ENST00000333763 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENST00000333763 MI0003178 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000333763 MI0003182 hsa-miR-519a AAAGUGCAUCCUUUUAGAGUGU
ENST00000333763 MI0003151 hsa-miR-519b-3p AAAGUGCAUCCUUUUAGAGGUU
ENST00000333763 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000333763 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000333763 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENST00000333763 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENST00000333763 MI0003573 hsa-miR-567 AGUAUGUUCUUCCAGGACAGAAC
ENST00000333763 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000333763 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000333763 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENST00000333763 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000333763 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000333763 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENST00000333763 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENST00000333763 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000333763 MI0005756 hsa-miR-934 UGUCUACUACUGGAGACACUGG
ENST00000333763 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000333763 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000333763 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000333763 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000333763 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000333763 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000333763 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000333763 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000333763 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000333763 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000333763 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000333763 MI0005474 mmu-miR-881 AACUGUGUCUUUUCUGAAUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased activity of NR1I3 protein] which results in increased expression of ABCC6 mRNA
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC6 mRNA
15833929
3,4,5,3',4'-pentachlorobiphenyl
  • [3,4,5,3',4'-pentachlorobiphenyl binds to AHR protein] which results in increased expression of ABCC6 mRNA
  • 3,4,5,3',4'-pentachlorobiphenyl results in increased expression of ABCC6 mRNA
15833929
Acetaminophen
  • Acetaminophen affects the expression of ABCC6 mRNA
17562736
alitretinoin
  • RARA protein promotes the reaction [alitretinoin results in increased expression of ABCC6 mRNA]
  • alitretinoin results in increased expression of ABCC6 mRNA
17045963
beta-Naphthoflavone
  • [beta-Naphthoflavone binds to AHR protein] which results in increased expression of ABCC6 mRNA
  • beta-Naphthoflavone results in increased expression of ABCC6 mRNA
15833929
Butylated Hydroxyanisole
  • [Butylated Hydroxyanisole results in increased activity of NFE2L2 protein] which results in increased expression of ABCC6 mRNA
  • Butylated Hydroxyanisole results in increased expression of ABCC6 mRNA
15833929
calcein AM
  • Glutathione promotes the reaction [ABCC6 protein affects the transport of calcein AM]
15210835
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of ABCC6 mRNA
12734012
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCC6 protein
17544377
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCC6 mRNA
17602206
Dexamethasone
  • Dexamethasone affects the expression of ABCC6 mRNA
15102944
Dexamethasone
  • Dexamethasone results in decreased expression of ABCC6 mRNA
16260000
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCC6 mRNA
17602206
Ethoxyquin
  • [Ethoxyquin results in increased activity of NFE2L2 protein] which results in increased expression of ABCC6 mRNA
  • Ethoxyquin results in increased expression of ABCC6 mRNA
15833929
Glutathione
  • Glutathione promotes the reaction [ABCC6 protein affects the transport of calcein AM]
15210835
Isoniazid
  • Isoniazid results in decreased expression of ABCC6 mRNA
16260000
L 742694
  • L 742694 affects the expression of ABCC6 mRNA
15102944
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCC6 mRNA
15205389
oltipraz
  • [oltipraz results in increased activity of NFE2L2 protein] which results in increased expression of ABCC6 mRNA
  • oltipraz results in increased expression of ABCC6 mRNA
15833929
perfluorooctane sulfonic acid
  • perfluorooctane sulfonic acid results in increased expression of ABCC6 mRNA
16221955
Phenobarbital
  • Phenobarbital does not affect the expression of ABCC6 mRNA
11451172
Phenobarbital
  • Phenobarbital results in decreased expression of ABCC6 mRNA
16260000
Progesterone
  • Progesterone results in decreased expression of ABCC6 mRNA
18070364
Soybean Oil
  • Soybean Oil affects the expression of ABCC6 mRNA
15770074
Tetrachlorodibenzodioxin
  • [Tetrachlorodibenzodioxin binds to AHR protein] which results in increased expression of ABCC6 mRNA
  • Tetrachlorodibenzodioxin results in increased expression of ABCC6 mRNA
15833929
Tretinoin
  • Tretinoin results in increased expression of ABCC6 mRNA
17045963

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Pseudoxanthoma Elasticum marker 17045963
PSEUDOXANTHOMA ELASTICUM, FORME FRUSTE marker
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 17107899, 16788101, 16140955, 16331271, 17294898, 12679006, 15748426, 16823087, 16935935
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Glioblastoma inferred via perfluorooctane sulfonic acid 17162496
Liver Cirrhosis, Experimental inferred via oltipraz 16544323
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Hepatitis, Toxic inferred via Isoniazid 14986274, 17950035, 16770646
Mycobacterium Infections inferred via Isoniazid 18474467
Seizures inferred via Isoniazid 16107249
Tuberculosis inferred via Isoniazid 18397238, 15236969, 16770646, 17720495, 15673755, 17950035
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 17428255, 10737359, 10672840, 11831363
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 15885732, 16942905, 18648771, 10737359, 12112319
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Liver Neoplasms inferred via Clofibric Acid 17602206
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16097048, 10355542, 16124888, 16227642, 15700767, 16011737, 15673190, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 16239168, 12795759, 61145, 12631006, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 11566570, 15968718, 15027814, 16227642, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17557913, 18156304, 16638106, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 18395095, 17976157, 17805973, 16248980, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15830285, 15720792, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via alitretinoin 16344269
Keratosis, Seborrheic inferred via alitretinoin 16144296
Lung Neoplasms inferred via alitretinoin 16413115
Neoplasms inferred via alitretinoin 16946489
Porokeratosis inferred via alitretinoin 16144296
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Adenoma, Liver Cell inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245
Cholangiocarcinoma inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ratajewski M, et al. (2009) "Liver-specific enhancer in ABCC6 promoter-Functional evidence from natural polymorphisms." Biochem Biophys Res Commun. 383(1):73-77. PMID:19341707
  2. [ + ] Li Q, et al. (2009) "Mutations in the GGCX and ABCC6 genes in a family with pseudoxanthoma elasticum-like phenotypes." J Invest Dermatol. 129(3):553-563. PMID:18800149
  3. [ + ] Finger RP, et al. (2009) "Pseudoxanthoma elasticum: genetics, clinical manifestations and therapeutic approaches." Surv Ophthalmol. 54(2):272-285. PMID:19298904
  4. [ + ] Sato N, et al. (2009) "Novel mutations of ABCC6 gene in Japanese patients with Angioid streaks." Biochem Biophys Res Commun. 380(3):548-553. PMID:19284998
  5. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  6. [ + ] Fulop K, et al. (2009) "Clustering of disease-causing mutations on the domain-domain interfaces of ABCC6." Biochem Biophys Res Commun. 379(3):706-709. PMID:19133228
  7. [ + ] Yoshida T, et al. (2009) "Association of a polymorphism of the apolipoprotein E gene with chronic kidney disease in Japanese individuals with metabolic syndrome." Genomics. 93(3):221-226. PMID:19056482
  8. [ + ] Plomp AS, et al. (2008) "ABCC6 mutations in pseudoxanthoma elasticum: an update including eight novel ones." Mol Vis. 14():118-124. PMID:18253096
  9. [ + ] Drera B, et al. (2008) "Compound heterozygosity for a novel and a recurrent ABCC6 gene mutation in an Italian family with Pseudoxanthoma elasticum." J Dermatol Sci. 49(3):252-255. PMID:18029147
  10. [ + ] Ratajewski M, et al. (2008) "The human pseudoxanthoma elasticum gene ABCC6 is transcriptionally regulated by PLAG family transcription factors." Hum Genet. 124(5):451-463. PMID:18850323
  11. [ + ] Symmons O, et al. (2008) "How segmental duplications shape our genome: recent evolution of ABCC6 and PKD1 Mendelian disease genes." Mol Biol Evol. 25(12):2601-2613. PMID:18791038
  12. [ + ] Kamata S, et al. (2008) "Expression and localization of ATP binding cassette (ABC) family of drug transporters in gastric hepatoid adenocarcinomas." Histopathology. 52(6):747-754. PMID:18439156
  13. [ + ] Martin L, et al. (2008) "Heterozygosity for a single mutation in the ABCC6 gene may closely mimic PXE: consequences of this phenotype overlap for the definition of PXE." Arch Dermatol. 144(3):301-306. PMID:18347285
  14. [ + ] Gotting C, et al. (2008) "Circulating P-, L- and E-selectins in pseudoxanthoma elasticum patients." Clin Biochem. 41(6):368-374. PMID:18191640
  15. [ + ] Pfendner EG, et al. (2007) "Mutation detection in the ABCC6 gene and genotype-phenotype analysis in a large international case series affected by pseudoxanthoma elasticum." J Med Genet. 44(10):621-628. PMID:17617515
  16. [ + ] Chassaing N, et al. (2007) "ABCC6 is unlikely to be a modifier gene for familial Mediterranean fever severity." J Genet. 86(3):293-295. PMID:18305351
  17. [ + ] Pan J, et al. (2007) "The hepatitis B x antigen effector, URG7, blocks tumour necrosis factor alpha-mediated apoptosis by activation of phosphoinositol 3-kinase and beta-catenin." J Gen Virol. 88(Pt 12):3275-3285. PMID:18024896
  18. [ + ] Bowen AR, et al. (2007) "Pseudoxanthoma elasticum-like fibers in the inflamed skin of patients without pseudoxanthoma elasticum." J Cutan Pathol. 34(10):777-781. PMID:17880583
  19. [ + ] Chassaing N, et al. (2007) "Contribution of ABCC6 genomic rearrangements to the diagnosis of pseudoxanthoma elasticum in French patients." Hum Mutat. 28(10):1046. PMID:17823974
  20. [ + ] Audo I, et al. (2007) "Pseudoxanthoma elasticum with generalized retinal dysfunction, a common finding?" Invest Ophthalmol Vis Sci. 48(9):4250-4256. PMID:17724214
  21. [ + ] Martin L, et al. (2007) "Histological skin changes in heterozygote carriers of mutations in ABCC6, the gene causing pseudoxanthoma elasticum." J Eur Acad Dermatol Venereol. 21(3):368-373. PMID:17309461
  22. [ + ] Le Saux O, et al. (2006) "Serum factors from pseudoxanthoma elasticum patients alter elastic fiber formation in vitro." J Invest Dermatol. 126(7):1497-1505. PMID:16543900
  23. [ + ] Ratajewski M, et al. (2006) "Expression of the human ABCC6 gene is induced by retinoids through the retinoid X receptor." Biochem Biophys Res Commun. 350(4):1082-1087. PMID:17045963
  24. [ + ] Schulz V, et al. (2006) "Mutational analysis of the ABCC6 gene and the proximal ABCC6 gene promoter in German patients with pseudoxanthoma elasticum (PXE)." Hum Mutat. 27(8):831. PMID:16835894
  25. [ + ] Jiang Q, et al. (2006) "Transcriptional regulation and characterization of the promoter region of the human ABCC6 gene." J Invest Dermatol. 126(2):325-335. PMID:16374464
  26. [ + ] Hendig D, et al. (2005) "New ABCC6 gene mutations in German pseudoxanthoma elasticum patients." J Mol Med. 83(2):140-147. PMID:15723264
  27. [ + ] Aranyi T, et al. (2005) "Identification of a DNA methylation-dependent activator sequence in the pseudoxanthoma elasticum gene, ABCC6." J Biol Chem. 280(19):18643-18650. PMID:15760889
  28. [ + ] Beck K, et al. (2005) "Analysis of ABCC6 (MRP6) in normal human tissues." Histochem Cell Biol. 123(4-5):517-528. PMID:15889270
  29. [ + ] Chassaing N, et al. (2005) "Pseudoxanthoma elasticum: a clinical, pathophysiological and genetic update including 11 novel ABCC6 mutations." J Med Genet. 42(12):881-892. PMID:15894595
  30. [ + ] Uitto J, et al. (2005) "The gene family of ABC transporters--novel mutations, new phenotypes." Trends Mol Med. 11(8):341-343. PMID:15996518
  31. [ + ] Miksch S, et al. (2005) "Molecular genetics of pseudoxanthoma elasticum: type and frequency of mutations in ABCC6." Hum Mutat. 26(3):235-248. PMID:16086317
  32. [ + ] Schulz V, et al. (2005) "Analysis of sequence variations in the ABCC6 gene among patients with abdominal aortic aneurysm and pseudoxanthoma elasticum." J Vasc Res. 42(5):424-432. PMID:16127278
  33. [ + ] Schulz V, et al. (2005) "Novel mutations in the ABCC6 gene of German patients with pseudoxanthoma elasticum." Hum Biol. 77(3):367-384. PMID:16392638
  34. [ + ] Hu X, et al. (2004) "Efficient molecular diagnostic strategy for ABCC6 in pseudoxanthoma elasticum." Genet Test. 8(3):292-300. PMID:15727254
  35. [ + ] Noji Y, et al. (2004) "Identification of two novel missense mutations (p.R1221C and p.R1357W) in the ABCC6 (MRP6) gene in a Japanese patient with pseudoxanthoma elasticum (PXE)." Intern Med. 43(12):1171-1176. PMID:15645653
  36. [ + ] Gheduzzi D, et al. (2004) "ABCC6 mutations in Italian families affected by pseudoxanthoma elasticum (PXE)." Hum Mutat. 24(5):438-439. PMID:15459974
  37. [ + ] Gotting C, et al. (2004) "Assessment of a rapid-cycle PCR assay for the identification of the recurrent c.3421C>T mutation in the ABCC6 gene in pseudoxanthoma elasticum patients." Lab Invest. 84(1):122-130. PMID:14631379
  38. [ + ] Hu X, et al. (2003) "Analysis of the frequent R1141X mutation in the ABCC6 gene in pseudoxanthoma elasticum." Invest Ophthalmol Vis Sci. 44(5):1824-1829. PMID:12714611
  39. [ + ] Hu X, et al. (2003) "ABCC6/MRP6 mutations: further insight into the molecular pathology of pseudoxanthoma elasticum." Eur J Hum Genet. 11(3):215-224. PMID:12673275
  40. [ + ] Sinko E, et al. (2003) "Subcellular localization and N-glycosylation of human ABCC6, expressed in MDCKII cells." Biochem Biophys Res Commun. 308(2):263-269. PMID:12901863
  41. [ + ] Hu X, et al. (2003) "Pseudoxanthoma elasticum: a clinical, histopathological, and molecular update." Surv Ophthalmol. 48(4):424-438. PMID:12850230
  42. [ + ] Trip MD, et al. (2002) "Frequent mutation in the ABCC6 gene (R1141X) is associated with a strong increase in the prevalence of coronary artery disease." Circulation. 106(7):773-775. PMID:12176944
  43. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  44. [ + ] Le Saux O, et al. (2002) "Evidence for a founder effect for pseudoxanthoma elasticum in the Afrikaner population of South Africa." Hum Genet. 111(4-5):331-338. PMID:12384774
  45. [ + ] Ilias A, et al. (2002) "Loss of ATP-dependent transport activity in pseudoxanthoma elasticum-associated mutants of human ABCC6 (MRP6)." J Biol Chem. 277(19):16860-16867. PMID:11880368
  46. [ + ] Lian Z, et al. (2001) "A cellular gene up-regulated by hepatitis B virus-encoded X antigen promotes hepatocellular growth and survival." Hepatology. 34(1):146-157. PMID:11431746
  47. [ + ] Wang J, et al. (2001) "ABCC6 gene polymorphism associated with variation in plasma lipoproteins." J Hum Genet. 46(12):699-705. PMID:11776382
  48. [ + ] Pulkkinen L, et al. (2001) "Identification of ABCC6 pseudogenes on human chromosome 16p: implications for mutation detection in pseudoxanthoma elasticum." Hum Genet. 109(3):356-365. PMID:11702217
  49. [ + ] Le Saux O, et al. (2001) "A spectrum of ABCC6 mutations is responsible for pseudoxanthoma elasticum." Am J Hum Genet. 69(4):749-764. PMID:11536079