Aasdh | GeneID:364136 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 364136 Official Symbol Aasdh
Locus N/A Gene Type protein-coding
Synonyms RGD1311135
Full Name aminoadipate-semialdehyde dehydrogenase
Description aminoadipate-semialdehyde dehydrogenase
Chromosome 14p11
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 71711

ID Symbol Protein Species
GeneID:34175 U26 NP_609230.2 Drosophila melanogaster
GeneID:132949 AASDH NP_861522.2 Homo sapiens
GeneID:231326 Aasdh NP_776126.1 Mus musculus
GeneID:364136 Aasdh XP_344231.2 Rattus norvegicus
GeneID:422744 AASDH XP_420697.2 Gallus gallus
GeneID:471237 AASDH XP_526619.2 Pan troglodytes
GeneID:482159 AASDH XP_539278.2 Canis lupus familiaris
GeneID:570338 si:dkeyp-117h8.3 XP_698902.2 Danio rerio
GeneID:782093 AASDH XP_001250589.1 Bos taurus
GeneID:833582 AT5G35930 NP_198442.2 Arabidopsis thaliana
GeneID:1279502 AgaP_AGAP010071 XP_319228.2 Anopheles gambiae
GeneID:4339893 Os06g0111600 NP_001056587.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_344230  UCSC Browser XP_344231
2 XR_009058  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000002907 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSRNOT00000002907 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSRNOT00000002907 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSRNOT00000002907 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSRNOT00000002907 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENSRNOT00000002907 MI0003562 hsa-miR-556-5p GAUGAGCUCAUUGUAAUAUGAG
ENSRNOT00000002907 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENSRNOT00000002907 MI0005540 hsa-miR-889 UUAAUAUCGGACAACCAUUGU
ENSRNOT00000002907 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENSRNOT00000002907 MI0005004 mmu-miR-615-3p UCCGAGCCUGGGUCUCCCUCUU
ENSRNOT00000002907 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSRNOT00000002907 MI0000949 rno-miR-208 AUAAGACGAGCAAAAAGCUUGU
ENSRNOT00000002907 MI0000622 rno-miR-340-3p UCCGUCUCAGUUACUUUAUAGCC
ENSRNOT00000002907 MI0003552 rno-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSRNOT00000002907 MI0006147 rno-miR-434 UUUGAACCAUCACUCGACUCCU
ENSRNOT00000002907 MI0001654 rno-miR-450a UUUUUGCGAUGUGUUCCUAAUG
ENSRNOT00000002907 MI0006114 rno-miR-466c UGUGAUGUGUGCAUGUACAUG
ENSRNOT00000002907 MI0003477 rno-miR-489 AAUGACAUCACAUAUAUGGCAGC
ENSRNOT00000002907 MI0006160 rno-miR-708* CAACUAGACUGUGAGCUUCUAG
ENSRNOT00000002907 MI0006117 rno-miR-872* UGAACUAUUGCAGUAGCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene