Abcd1 | GeneID:363516 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 363516 Official Symbol Abcd1
Locus N/A Gene Type protein-coding
Synonyms RGD1562128
Full Name ATP-binding cassette, sub-family D (ALD), member 1
Description ATP-binding cassette, sub-family D (ALD), member 1
Chromosome Xq37
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55426

ID Symbol Protein Species
GeneID:215 ABCD1 NP_000024.2 Homo sapiens
GeneID:11666 Abcd1 NP_031461.1 Mus musculus
GeneID:363516 Abcd1 XP_343841.1 Rattus norvegicus
GeneID:515178 ABCD1 NP_001039655.1 Bos taurus
GeneID:566367 zgc:172102 NP_001104656.1 Danio rerio
GeneID:612520 ABCD1 XP_855341.1 Canis lupus familiaris
GeneID:2684880 MGG_06707 XP_370210.2 Magnaporthe grisea
GeneID:2709950 NCU01751.1 XP_328190.1 Neurospora crassa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005778 Component peroxisomal membrane
GO:0005524 Function ATP binding
GO:0042802 Function identical protein binding
GO:0005515 Function protein binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001108821  UCSC Browser NP_001102291
2 XM_001059399  UCSC Browser XP_001059399
3 XM_343840  UCSC Browser XP_343841

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000025863 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSRNOT00000025863 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSRNOT00000025863 MI0000892 rno-miR-124 UAAGGCACGCGGUGAAUGCC
ENSRNOT00000025863 MI0000893 rno-miR-124 UAAGGCACGCGGUGAAUGCC
ENSRNOT00000025863 MI0000894 rno-miR-124 UAAGGCACGCGGUGAAUGCC
ENSRNOT00000025863 MI0000947 rno-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSRNOT00000025863 MI0000961 rno-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSRNOT00000025863 MI0000962 rno-miR-222 AGCUACAUCUGGCUACUGGGU
ENSRNOT00000025863 MI0000967 rno-miR-296* AGGGCCCCCCCUCAAUCCUGU
ENSRNOT00000025863 MI0000594 rno-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSRNOT00000025863 MI0006159 rno-miR-674-5p GCACUGAGAUGGGAGUGGUGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tanaka AR, et al. (2002) "ATP binding/hydrolysis by and phosphorylation of peroxisomal ATP-binding cassette proteins PMP70 (ABCD3) and adrenoleukodystrophy protein (ABCD1)." J Biol Chem. 277(42):40142-40147. PMID:12176987
  2. [ + ] Contreras M, et al. (1996) "Topology of ATP-binding domain of adrenoleukodystrophy gene product in peroxisomes." Arch Biochem Biophys. 334(2):369-379. PMID:8900413