Abcb8 | GeneID:362302 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 362302 | Official Symbol | Abcb8 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | MGC93731 | ||
| Full Name | ATP-binding cassette, sub-family B (MDR/TAP), member 8 | ||
| Description | ATP-binding cassette, sub-family B (MDR/TAP), member 8 | ||
| Chromosome | 4q11 | ||
| Also Known As | ABC transporter 8; ATP-binding cassette, sub-family B, member 8 | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 5203
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:11194 | ABCB8 | NP_009119.2 | Homo sapiens |
| GeneID:32208 | CG1824 | NP_572810.1 | Drosophila melanogaster |
| GeneID:74610 | Abcb8 | NP_083296.2 | Mus musculus |
| GeneID:171694 | haf-6 | NP_490828.3 | Caenorhabditis elegans |
| GeneID:362302 | Abcb8 | NP_001007797.1 | Rattus norvegicus |
| GeneID:463892 | ABCB8 | XP_519524.2 | Pan troglodytes |
| GeneID:482800 | ABCB8 | XP_539916.2 | Canis lupus familiaris |
| GeneID:548340 | zgc:113037 | NP_001017544.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0016020 | Component | membrane |
| GO:0005743 | Component | mitochondrial inner membrane |
| GO:0005739 | Component | mitochondrion |
| GO:0016887 | Function | ATPase activity |
| GO:0042626 | Function | ATPase activity, coupled to transmembrane movement of substances |
| GO:0005524 | Function | ATP binding |
| GO:0000166 | Function | nucleotide binding |
| GO:0006810 | Process | transport |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001007796 UCSC Browser | NP_001007797 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000012222 | MI0004999 | gga-miR-757 | GCAGAGCUGCAGAUGGGAUUC |
| ENSRNOT00000012222 | MI0005000 | gga-miR-757 | GCAGAGCUGCAGAUGGGAUUC |
| ENSRNOT00000012222 | MI0000780 | hsa-miR-372 | AAAGUGCUGCGACAUUUGAGCGU |
| ENSRNOT00000012222 | MI0000781 | hsa-miR-373 | GAAGUGCUUCGAUUUUGGGGUGU |
| ENSRNOT00000012222 | MI0003195 | hsa-miR-508-5p | UACUCCAGAGGGCGUCACUCAUG |
| ENSRNOT00000012222 | MI0003149 | hsa-miR-520a-3p | AAAGUGCUUCCCUUUGGACUGU |
| ENSRNOT00000012222 | MI0003597 | hsa-miR-588 | UUGGCCACAAUGGGUUAGAAC |
| ENSRNOT00000012222 | MI0003649 | hsa-miR-634 | AACCAGCACCCCAACUUUGGAC |
| ENSRNOT00000012222 | MI0003653 | hsa-miR-638 | AGGGAUCGCGGGCGGGUGGCGGCCU |
| ENSRNOT00000012222 | MI0003666 | hsa-miR-651 | UUUAGGAUAAGCUUGACUUUUG |
| ENSRNOT00000012222 | MI0003836 | hsa-miR-766 | ACUCCAGCCCCACAGCCUCAGC |
| ENSRNOT00000012222 | MI0005760 | hsa-miR-938 | UGCCCUUAAAGGUGAACCCAGU |
| ENSRNOT00000012222 | MI0005763 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000012222 | MI0005764 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000012222 | MI0005765 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000012222 | MI0005766 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000012222 | MI0005481 | mmu-miR-105 | CCAAGUGCUCAGAUGCUUGUGGU |
| ENSRNOT00000012222 | MI0000393 | mmu-miR-295 | AAAGUGCUACUACUUUUGAGUCU |
| ENSRNOT00000012222 | MI0003531 | mmu-miR-367 | AAUUGCACUUUAGCAAUGGUGA |
| ENSRNOT00000012222 | MI0005516 | mmu-miR-509-5p | UACUCCAGAAUGUGGCAAUCAU |
| ENSRNOT00000012222 | MI0005003 | mmu-miR-676 | CCGUCCUGAGGUUGUUGAGCU |
| ENSRNOT00000012222 | MI0004681 | mmu-miR-697 | AACAUCCUGGUCCUGUGGAGA |
| ENSRNOT00000012222 | MI0004689 | mmu-miR-705 | GGUGGGAGGUGGGGUGGGCA |
| ENSRNOT00000012222 | MI0004678 | mmu-miR-720 | AUCUCGCUGGGGCCUCCA |
| ENSRNOT00000012222 | MI0000832 | rno-let-7e* | CUAUACGGCCUCCUAGCUUUCC |
| ENSRNOT00000012222 | MI0000887 | rno-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENSRNOT00000012222 | MI0000888 | rno-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENSRNOT00000012222 | MI0000896 | rno-miR-125b-3p | ACGGGUUAGGCUCUUGGGAGCU |
| ENSRNOT00000012222 | MI0000906 | rno-miR-133a | UUUGGUCCCCUUCAACCAGCUG |
| ENSRNOT00000012222 | MI0003490 | rno-miR-133b | UUUGGUCCCCUUCAACCAGCUA |
| ENSRNOT00000012222 | MI0000611 | rno-miR-140 | CAGUGGUUUUACCCUAUGGUAG |
| ENSRNOT00000012222 | MI0000611 | rno-miR-140* | UACCACAGGGUAGAACCACGG |
| ENSRNOT00000012222 | MI0000920 | rno-miR-150 | UCUCCCAACCCUUGUACCAGUG |
| ENSRNOT00000012222 | MI0000936 | rno-miR-193 | AACUGGCCUACAAAGUCCCAGU |
| ENSRNOT00000012222 | MI0000856 | rno-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENSRNOT00000012222 | MI0000968 | rno-miR-297 | AUGUAUGUGUGCAUGUAUGCAUG |
| ENSRNOT00000012222 | MI0000602 | rno-miR-328 | CUGGCCCUCUCUGCCCUUCCGU |
| ENSRNOT00000012222 | MI0000875 | rno-miR-34b | UAGGCAGUGUAAUUAGCUGAUUG |
| ENSRNOT00000012222 | MI0000644 | rno-miR-352 | AGAGUAGUAGGUUGCAUAGUA |
| ENSRNOT00000012222 | MI0003553 | rno-miR-363 | AAUUGCACGGUAUCCAUCUGUA |
| ENSRNOT00000012222 | MI0006151 | rno-miR-484 | UCAGGCUCAGUCCCCUCCCGAU |
| ENSRNOT00000012222 | MI0006154 | rno-miR-532-3p | CCUCCCACACCCAAGGCUUGCA |
| ENSRNOT00000012222 | MI0000878 | rno-miR-92a | UAUUGCACUUGUCCCGGCCUG |
| ENSRNOT00000012222 | MI0000879 | rno-miR-92a | UAUUGCACUUGUCCCGGCCUG |
| ENSRNOT00000012222 | MI0006167 | rno-miR-92b | UAUUGCACUCGUCCCGGCCUCC |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Melaine N, et al. (2006) "Molecular cloning of several rat ABC transporters including a new ABC transporter, Abcb8, and their expression in rat testis." Int J Androl. 29(3):392-399. PMID:16390497 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
Several members of the ABC transporter superfamily play an important role in testicular physiology and defence against anticancer drugs. Using a reverse transcription-polymerase chain reaction strategy with degenerate primers and rat testis RNA as template, we have looked for the presence of other members of this superfamily. Of the six partial cDNA found, five corresponded to ABC transporters already known -Mdr1b, Mrp1, Tapl/Abcb9, Umat/Abcb6 and Sur2/Abcc9- and one presented a strong homology with mouse and human ABCB8. Using a 5' and 3' RACE approach, we cloned the full-length cDNA and found that the predicted protein presented 92% and 80% homology with the mouse and human proteins respectively. Strong expression of rat abcb8 was found in heart, brain and testis when compared with liver, lung and spleen. In the testis, rat abcb8 was expressed both in the somatic Sertoli cells and peritubular cells and in the germline (spermatogonia and pachytene spermatocytes). Furthermore, Umat/Abcb6 was very highly expressed in the testis (high amounts in meiotic pachytene spermatocytes and low amount in post-meiotic early spermatids). In conclusion, we confirm the presence of several ABC transporters in the testis and also provide evidence of the presence of Abcb8 in the organ.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).