Abcb8 | GeneID:362302 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 362302 Official Symbol Abcb8
Locus N/A Gene Type protein-coding
Synonyms MGC93731
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 8
Description ATP-binding cassette, sub-family B (MDR/TAP), member 8
Chromosome 4q11
Also Known As ABC transporter 8; ATP-binding cassette, sub-family B, member 8
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5203

ID Symbol Protein Species
GeneID:11194 ABCB8 NP_009119.2 Homo sapiens
GeneID:32208 CG1824 NP_572810.1 Drosophila melanogaster
GeneID:74610 Abcb8 NP_083296.2 Mus musculus
GeneID:171694 haf-6 NP_490828.3 Caenorhabditis elegans
GeneID:362302 Abcb8 NP_001007797.1 Rattus norvegicus
GeneID:463892 ABCB8 XP_519524.2 Pan troglodytes
GeneID:482800 ABCB8 XP_539916.2 Canis lupus familiaris
GeneID:548340 zgc:113037 NP_001017544.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005743 Component mitochondrial inner membrane
GO:0005739 Component mitochondrion
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001007796  UCSC Browser NP_001007797

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000012222 MI0004999 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSRNOT00000012222 MI0005000 gga-miR-757 GCAGAGCUGCAGAUGGGAUUC
ENSRNOT00000012222 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENSRNOT00000012222 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSRNOT00000012222 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENSRNOT00000012222 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENSRNOT00000012222 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSRNOT00000012222 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSRNOT00000012222 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSRNOT00000012222 MI0003666 hsa-miR-651 UUUAGGAUAAGCUUGACUUUUG
ENSRNOT00000012222 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000012222 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSRNOT00000012222 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000012222 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000012222 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000012222 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000012222 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSRNOT00000012222 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENSRNOT00000012222 MI0003531 mmu-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSRNOT00000012222 MI0005516 mmu-miR-509-5p UACUCCAGAAUGUGGCAAUCAU
ENSRNOT00000012222 MI0005003 mmu-miR-676 CCGUCCUGAGGUUGUUGAGCU
ENSRNOT00000012222 MI0004681 mmu-miR-697 AACAUCCUGGUCCUGUGGAGA
ENSRNOT00000012222 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSRNOT00000012222 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENSRNOT00000012222 MI0000832 rno-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENSRNOT00000012222 MI0000887 rno-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSRNOT00000012222 MI0000888 rno-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSRNOT00000012222 MI0000896 rno-miR-125b-3p ACGGGUUAGGCUCUUGGGAGCU
ENSRNOT00000012222 MI0000906 rno-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSRNOT00000012222 MI0003490 rno-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSRNOT00000012222 MI0000611 rno-miR-140 CAGUGGUUUUACCCUAUGGUAG
ENSRNOT00000012222 MI0000611 rno-miR-140* UACCACAGGGUAGAACCACGG
ENSRNOT00000012222 MI0000920 rno-miR-150 UCUCCCAACCCUUGUACCAGUG
ENSRNOT00000012222 MI0000936 rno-miR-193 AACUGGCCUACAAAGUCCCAGU
ENSRNOT00000012222 MI0000856 rno-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSRNOT00000012222 MI0000968 rno-miR-297 AUGUAUGUGUGCAUGUAUGCAUG
ENSRNOT00000012222 MI0000602 rno-miR-328 CUGGCCCUCUCUGCCCUUCCGU
ENSRNOT00000012222 MI0000875 rno-miR-34b UAGGCAGUGUAAUUAGCUGAUUG
ENSRNOT00000012222 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA
ENSRNOT00000012222 MI0003553 rno-miR-363 AAUUGCACGGUAUCCAUCUGUA
ENSRNOT00000012222 MI0006151 rno-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSRNOT00000012222 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENSRNOT00000012222 MI0000878 rno-miR-92a UAUUGCACUUGUCCCGGCCUG
ENSRNOT00000012222 MI0000879 rno-miR-92a UAUUGCACUUGUCCCGGCCUG
ENSRNOT00000012222 MI0006167 rno-miR-92b UAUUGCACUCGUCCCGGCCUCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Melaine N, et al. (2006) "Molecular cloning of several rat ABC transporters including a new ABC transporter, Abcb8, and their expression in rat testis." Int J Androl. 29(3):392-399. PMID:16390497
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932