Abcb10 | GeneID:361439 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 361439 Official Symbol Abcb10
Locus N/A Gene Type protein-coding
Synonyms MGC109142
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 10
Description ATP-binding cassette, sub-family B (MDR/TAP), member 10
Chromosome 19q12
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6474

ID Symbol Protein Species
GeneID:23456 ABCB10 NP_036221.1 Homo sapiens
GeneID:30994 CG3156 NP_569844.2 Drosophila melanogaster
GeneID:56199 Abcb10 NP_062425.1 Mus musculus
GeneID:178522 haf-1 NP_503098.2 Caenorhabditis elegans
GeneID:180056 haf-3 NP_506927.1 Caenorhabditis elegans
GeneID:361439 Abcb10 NP_001012166.1 Rattus norvegicus
GeneID:421537 ABCB10 XP_419578.2 Gallus gallus
GeneID:789800 ABCB10 XP_001256449.1 Bos taurus
GeneID:814343 MAL3P1.7 XP_001351101.1 Plasmodium falciparum
GeneID:833896 ATTAP2 NP_198720.2 Arabidopsis thaliana
GeneID:855858 MDL2 NP_015053.2 Saccharomyces cerevisiae
GeneID:1273250 AgaP_AGAP002717 XP_563428.1 Anopheles gambiae
GeneID:2541285 mdl1 NP_595751.1 Schizosaccharomyces pombe
GeneID:2685051 MGG_06878 XP_370381.2 Magnaporthe grisea
GeneID:2705539 NCU04117.1 XP_323457.1 Neurospora crassa
GeneID:2893314 KLLA0D00748g XP_453105.1 Kluyveromyces lactis
GeneID:4334151 Os03g0755100 NP_001051311.1 Oryza sativa
GeneID:4619550 AGOS_ACR022W NP_983425.1 Eremothecium gossypii
GeneID:100003744 LOC100003744 XP_001343218.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005743 Component mitochondrial inner membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001012166  UCSC Browser NP_001012166

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000024232 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000024232 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSRNOT00000024232 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENSRNOT00000024232 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSRNOT00000024232 MI0000915 rno-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENSRNOT00000024232 MI0000932 rno-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENSRNOT00000024232 MI0000589 rno-miR-322* AAACAUGAAGCGCUGCAACA
ENSRNOT00000024232 MI0000883 rno-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENSRNOT00000024232 MI0000884 rno-miR-99b CACCCGUAGAACCGACCUUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932