Abce1 | GeneID:361390 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 361390 Official Symbol Abce1
Locus N/A Gene Type protein-coding
Synonyms Oabp; Rns4i
Full Name ATP-binding cassette, sub-family E (OABP), member 1
Description ATP-binding cassette, sub-family E (OABP), member 1
Chromosome 19q11
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 2205

ID Symbol Protein Species
GeneID:6059 ABCE1 NP_001035809.1 Homo sapiens
GeneID:24015 Abce1 NP_056566.2 Mus musculus
GeneID:39027 CG5651 NP_648272.1 Drosophila melanogaster
GeneID:176733 abce-1 NP_499717.1 Caenorhabditis elegans
GeneID:361390 Abce1 XP_001064797.1 Rattus norvegicus
GeneID:406324 abce1 NP_998216.1 Danio rerio
GeneID:422462 ABCE1 NP_001006440.1 Gallus gallus
GeneID:461523 ABCE1 XP_517465.1 Pan troglodytes
GeneID:475454 ABCE1 XP_532679.2 Canis lupus familiaris
GeneID:514991 ABCE1 XP_592921.3 Bos taurus
GeneID:813912 MAL13P1.344 XP_001350392.1 Plasmodium falciparum
GeneID:827661 ATRLI2 NP_193656.2 Arabidopsis thaliana
GeneID:851665 RLI1 NP_010376.1 Saccharomyces cerevisiae
GeneID:1269374 AgaP_AGAP002182 XP_308004.2 Anopheles gambiae
GeneID:2539753 SPBC14F5.06 NP_596732.1 Schizosaccharomyces pombe
GeneID:2677986 MGG_11382 XP_362155.2 Magnaporthe grisea
GeneID:2712409 NCU03061.1 XP_330497.1 Neurospora crassa
GeneID:2891913 KLLA0C17556g XP_452984.1 Kluyveromyces lactis
GeneID:4350692 Os11g0546000 NP_001068062.1 Oryza sativa
GeneID:4623093 AGOS_AGR125W NP_986791.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab32270 ABCE1 antibody (ab32270); Rabbit polyclonal to ABCE1

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005739 Component mitochondrion

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001108446  UCSC Browser NP_001101916
2 XM_001064797  UCSC Browser XP_001064797
3 XM_001070444  UCSC Browser XP_001070444
4 XM_001070484  UCSC Browser XP_001070484
5 XM_341669  UCSC Browser XP_341670

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000024753 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000024753 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENSRNOT00000024753 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSRNOT00000024753 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSRNOT00000024753 MI0000841 rno-miR-10a-3p CAAAUUCGUAUCUAGGGGAAUA
ENSRNOT00000024753 MI0000921 rno-miR-152 UCAGUGCAUGACAGAACUUGG
ENSRNOT00000024753 MI0000874 rno-miR-33 GUGCAUUGUAGUUGCAUUGCA
ENSRNOT00000024753 MI0003552 rno-miR-374 AUAUAAUACAACCUGCUAAGUG
ENSRNOT00000024753 MI0006147 rno-miR-434 UUUGAACCAUCACUCGACUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene