AC8.12 | GeneID:3565919 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 3565919 Official Symbol AC8.12
Locus AC8.12 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001026210 NP_001021381

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
AC8.12 MI0000344 cel-miR-264 GGCGGGUGGUUGUUGUUAUG
AC8.12 MI0000051 cel-miR-80 UGAGAUCAUUAGUUGAAAGCCGA
AC8.7 MI0000344 cel-miR-264 GGCGGGUGGUUGUUGUUAUG
AC8.7 MI0000051 cel-miR-80 UGAGAUCAUUAGUUGAAAGCCGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene