2RSSE.2 | GeneID:3565671 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 3565671 Official Symbol 2RSSE.2
Locus 2RSSE.2 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001025938 NP_001021109

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
2RSSE.2 MI0000310 cel-miR-235 UAUUGCACUCUCCCCGGCCUGA
2RSSE.2 MI0000326 cel-miR-250 AAUCACAGUCAACUGUUGGCA
2RSSE.2 MI0000348 cel-miR-268 GGCAAGAAUUAGAAGCAGUUUGGU
2RSSE.2 MI0000752 cel-miR-353 CAAUUGCCAUGUGUUGGUAUU
2RSSE.2 MI0000030 cel-miR-59 UCGAAUCGUUUAUCAGGAUGAUG
2RSSE.2 MI0000038 cel-miR-67 UCACAACCUCCUAGAAAGAGUAGA
2RSSE.2 MI0000046 cel-miR-75 UUAAAGCUACCAACCGGCUUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene