AC8.10 | GeneID:3565040 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 3565040 Official Symbol AC8.10
Locus AC8.10 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001026208 NP_001021379

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
AC8.10 MI0000311 cel-miR-236 UAAUACUGUCAGGUAAUGACGCU
AC8.10 MI0000335 cel-miR-258 GGUUUUGAGAGGAAUCCUUUU
AC8.10 MI0000352 cel-miR-272 UGUAGGCAUGGGUGUUUG
AC8.10 MI0000758 cel-miR-359 UCACUGGUCUUUCUCUGACGAA
AC8.10 MI0000049 cel-miR-78 UGGAGGCCUGGUUGUUUGUGC
AC8.3 MI0000311 cel-miR-236 UAAUACUGUCAGGUAAUGACGCU
AC8.3 MI0000335 cel-miR-258 GGUUUUGAGAGGAAUCCUUUU
AC8.3 MI0000352 cel-miR-272 UGUAGGCAUGGGUGUUUG
AC8.3 MI0000758 cel-miR-359 UCACUGGUCUUUCUCUGACGAA
AC8.3 MI0000049 cel-miR-78 UGGAGGCCUGGUUGUUUGUGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene