2RSSE.1 | GeneID:353411 | Caenorhabditis elegans

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 353411 Official Symbol 2RSSE.1
Locus 2RSSE.1 Gene Type protein-coding
Synonyms
Full Name N/A
Description hypothetical protein
Chromosome N/A
Also Known As
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005622 Component intracellular
GO:0007165 Process signal transduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_182258 NP_872058

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
2RSSE.1 MI0000302 cel-miR-124 UAAGGCACGCGGUGAAUGCCA
2RSSE.1 MI0000038 cel-miR-67 UCACAACCUCCUAGAAAGAGUAGA
2RSSE.1 MI0005198 cel-miR-797 UAUCACAGCAAUCACAAUGAGAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

NM_182258  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Mulder NJ, et al. (2003) "The InterPro Database, 2003 brings increased coverage and new features." Nucleic Acids Res. 31(1):315-318. PMID:12520011
  2. [ + ] Camon E, et al. (2003) "The Gene Ontology Annotation (GOA) project: implementation of GO in SWISS-PROT, TrEMBL, and InterPro." Genome Res. 13(4):662-672. PMID:12654719