AADACL2 | GeneID:344752 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 344752 Official Symbol AADACL2
Locus N/A Gene Type protein-coding
Synonyms MGC72001
Full Name arylacetamide deacetylase-like 2
Description arylacetamide deacetylase-like 2
Chromosome 3q25.1
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 28634

ID Symbol Protein Species
GeneID:295076 Aadacl2 XP_227188.2 Rattus norvegicus
GeneID:344752 AADACL2 NP_997248.1 Homo sapiens
GeneID:470969 AADACL2 XP_526352.2 Pan troglodytes
GeneID:609872 AADACL2 XP_852689.1 Canis lupus familiaris
GeneID:639634 Aadacl2 XP_991278.1 Mus musculus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab69440 AADACL2 antibody (ab69440); Mouse polyclonal to AADACL2

Exon, Intron and UTRs

Exon, Intron and UTRs of AADACL2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AADACL2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005576 Component extracellular region
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_207365  UCSC Browser NP_997248

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000356517 MI0000111 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000356517 MI0000112 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000356517 MI0000470 hsa-miR-125b-2* UCACAAGUCAGGCUCUUGGGAC
ENST00000356517 MI0000810 hsa-miR-135b* AUGUAGGGCUAAAAGCCAUGGG
ENST00000356517 MI0000456 hsa-miR-140-3p UACCACAGGGUAGAACCACGG
ENST00000356517 MI0000460 hsa-miR-144* GGAUAUCAUCAUAUACUGUAAG
ENST00000356517 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000356517 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000356517 MI0000274 hsa-miR-187* GGCUACAACACAGGACCCGGGC
ENST00000356517 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000356517 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000356517 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000356517 MI0000775 hsa-miR-367* ACUGUUGCUAAUAUGCAACUCU
ENST00000356517 MI0000784 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000356517 MI0003529 hsa-miR-376a AUCAUAGAGGAAAAUCCACGU
ENST00000356517 MI0002466 hsa-miR-376b AUCAUAGAGGAAAAUCCAUGUU
ENST00000356517 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000356517 MI0002465 hsa-miR-410 AAUAUAACACAGAUGGCCUGU
ENST00000356517 MI0003138 hsa-miR-497* CAAACCACACUGUGGUGUUAGA
ENST00000356517 MI0003183 hsa-miR-499-3p AACAUCACAGCAAGUCUGUGCU
ENST00000356517 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000356517 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000356517 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000356517 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000356517 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000356517 MI0000263 hsa-miR-7-1* CAACAAAUCACAGUCUGCCAUA
ENST00000356517 MI0000264 hsa-miR-7-2* CAACAAAUCCCAGUCUACCUAA
ENST00000356517 MI0005537 hsa-miR-888 UACUCAAAAAGCUGUCAGUCA
ENST00000356517 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000356517 MI0002400 mmu-miR-465a-5p UAUUUAGAAUGGCACUGAUGUGA
ENST00000356517 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000356517 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENST00000356517 MI0005500 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000356517 MI0005501 mmu-miR-465c-5p UAUUUAGAAUGGCGCUGAUCUG
ENST00000356517 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000356517 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENST00000356517 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENST00000356517 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000356517 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000356517 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000356517 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000356517 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000356517 MI0006128 mmu-miR-467e AUAAGUGUGAGCAUGUAUAUGU
ENST00000356517 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000356517 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENST00000356517 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Toulza E, et al. (2007) "Large-scale identification of human genes implicated in epidermal barrier function." Genome Biol. 8(6):R107. PMID:17562024
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932