AADACL4 | GeneID:343066 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 343066 Official Symbol AADACL4
Locus RP11-474O21.1 Gene Type protein-coding
Synonyms
Full Name arylacetamide deacetylase-like 4
Description arylacetamide deacetylase-like 4
Chromosome 1p36.21
Also Known As OTTHUMP00000001872
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 82530

ID Symbol Protein Species
GeneID:313688 RGD1565761 XP_233640.4 Rattus norvegicus
GeneID:343066 AADACL4 NP_001013652.1 Homo sapiens
GeneID:419479 AADACL4 XP_417635.2 Gallus gallus
GeneID:429936 LOC429936 XP_427491.2 Gallus gallus
GeneID:435815 OTTMUSG00000010747 NP_001074717.1 Mus musculus
GeneID:469815 AADACL4 XP_525200.2 Pan troglodytes
GeneID:569798 aadacl4 XP_698297.1 Danio rerio
GeneID:607688 AADACL4 XP_849554.1 Canis lupus familiaris
GeneID:768457 AADACL4 XP_001231394.1 Gallus gallus
GeneID:768489 LOC768489 XP_001231457.1 Gallus gallus
GeneID:768580 LOC768580 XP_001231604.1 Gallus gallus
GeneID:768597 LOC768597 XP_001231631.1 Gallus gallus
GeneID:768647 LOC768647 XP_001231701.1 Gallus gallus
GeneID:768668 AADACL3 XP_001231735.1 Gallus gallus

Exon, Intron and UTRs

Exon, Intron and UTRs of AADACL4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AADACL4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001013630  UCSC Browser NP_001013652

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000376221 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000376221 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000376221 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000376221 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000376221 MI0000111 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000376221 MI0000112 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000376221 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENST00000376221 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000376221 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000376221 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000376221 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000376221 MI0000461 hsa-miR-145 GUCCAGUUUUCCCAGGAAUCCCU
ENST00000376221 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000376221 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000376221 MI0000650 hsa-miR-200c UAAUACUGCCGGGUAAUGAUGGA
ENST00000376221 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENST00000376221 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000376221 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000376221 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000376221 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000376221 MI0000743 hsa-miR-34c-3p AAUCACUAACCACACGGCCAGG
ENST00000376221 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000376221 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000376221 MI0001641 hsa-miR-429 UAAUACUGUCUGGUAAAACCGU
ENST00000376221 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000376221 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000376221 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000376221 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000376221 MI0003159 hsa-miR-518c CAAAGCGCUUCUCUUUAGAGUGU
ENST00000376221 MI0003171 hsa-miR-518d-3p CAAAGCGCUUCCCUUUGGAGC
ENST00000376221 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000376221 MI0003154 hsa-miR-518f GAAAGCGCUUCUCUUUAGAGG
ENST00000376221 MI0003514 hsa-miR-539 GGAGAAAUUAUCCUUGGUGUGU
ENST00000376221 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000376221 MI0003563 hsa-miR-557 GUUUGCACGGGUGGGCCUUGUCU
ENST00000376221 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000376221 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENST00000376221 MI0003658 hsa-miR-643 ACUUGUAUGCUAGCUCAGGUAG
ENST00000376221 MI0005561 hsa-miR-877* UCCUCUUCUCCCUCCUCCCAG
ENST00000376221 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000376221 MI0002404 mmu-miR-469 UGCCUCUUUCAUUGAUCUUGGUGUCC
ENST00000376221 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000376221 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Gregory SG, et al. (2006) "The DNA sequence and biological annotation of human chromosome 1." Nature. 441(7091):315-321. PMID:16710414