ACADM | GeneID:34 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 34 Official Symbol ACADM
Locus RP4-682C21.1 Gene Type protein-coding
Synonyms ACAD1; FLJ18227; FLJ93013; FLJ99884; MCAD; MCADH
Full Name acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain
Description acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain
Chromosome 1p31
Also Known As OTTHUMP00000011345; medium-chain acyl-CoA dehydrogenase; medium-chain specific acyl-CoA dehydrogenase
Summary This gene encodes the medium-chain specific (C4 to C12 straight chain) acyl-Coenzyme A dehydrogenase. The homotetramer enzyme catalyzes the initial step of the mitochondrial fatty acid beta-oxidation pathway. Defects in this gene cause medium-chain acyl-CoA dehydrogenase deficiency, a disease characterized by hepatic dysfunction, fasting hypoglycemia, and encephalopathy, which can result in infantile death. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 3

ID Symbol Protein Species
GeneID:34 ACADM NP_000007.1 Homo sapiens
GeneID:11364 Acadm NP_031408.1 Mus musculus
GeneID:24158 Acadm NP_058682.1 Rattus norvegicus
GeneID:38864 CG12262 NP_648149.1 Drosophila melanogaster
GeneID:173979 K05F1.3 NP_495142.1 Caenorhabditis elegans
GeneID:181757 T08G2.3 NP_510788.1 Caenorhabditis elegans
GeneID:181758 T25G12.5 NP_510789.1 Caenorhabditis elegans
GeneID:406283 acadm NP_998175.1 Danio rerio
GeneID:469356 ACADM XP_524741.2 Pan troglodytes
GeneID:490207 ACADM XP_547328.2 Canis lupus familiaris
GeneID:505968 ACADM NP_001068703.1 Bos taurus
GeneID:1276346 AgaP_AGAP005662 XP_315683.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab23675 ACADM antibody (ab23675); Rabbit polyclonal to ACADM
2 abcam ab13677 ACADM antibody (ab13677); Goat polyclonal to ACADM
3 abnova H00000034-M04 ACADM monoclonal antibody (M04), clone 3A2; Mouse monoclonal antibody raised against a partial recombinant ACADM.
4 acris AP16078PU-N ACADM (C-term); antibody Ab
5 acris AP17862PU-N ACADM C-term; antibody Ab
6 acris AP08218PU-N ACADM; antibody Ab
7 acris AP17073PU-N ACADM (Center); antibody Ab
8 scbt ACADM ACADM Antibody / ACADM Antibodies;
9 sigma HPA006198 Anti-ACADM antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACADM Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACADM Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0003995 Function acyl-CoA dehydrogenase activity
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0055007 Process cardiac muscle cell differentiation
GO:0009437 Process carnitine metabolic process
GO:0006635 Process fatty acid beta-oxidation
GO:0006631 Process fatty acid metabolic process
GO:0007507 Process heart development
GO:0006629 Process lipid metabolic process
GO:0001889 Process liver development
GO:0006082 Process organic acid metabolic process
GO:0055114 Process oxidation reduction
GO:0009791 Process post-embryonic development
GO:0009409 Process response to cold
GO:0042594 Process response to starvation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000016  UCSC Browser NP_000007 Q5T4U4   P11310  
2 NM_001127328  UCSC Browser NP_001120800

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000370841 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000370841 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000370841 MI0000449 hsa-miR-132 UAACAGUCUACAGCCAUGGUCG
ENST00000370841 MI0000070 hsa-miR-16-1* CCAGUAUUAACUGUGCUGCUGA
ENST00000370841 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000370841 MI0000071 hsa-miR-17* ACUGCAGUGAAGGCACUUGUAG
ENST00000370841 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000370841 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000370841 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000370841 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENST00000370841 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000370841 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000370841 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in decreased expression of ACADM mRNA
17522070
Acetaminophen
  • Acetaminophen results in increased expression of ACADM protein
15800402
Acetaminophen
  • Acetaminophen results in decreased expression of ACADM mRNA
17522070
apocarotenal
  • apocarotenal results in increased expression of ACADM mRNA
17034753
bis(tri-n-butyltin)oxide
  • bis(tri-n-butyltin)oxide results in decreased expression of ACADM mRNA
17553608
Calcitriol
  • Calcitriol results in increased expression of ACADM mRNA
16002434
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACADM mRNA
17522070
Carbon Tetrachloride
  • Carbon Tetrachloride affects the expression of ACADM mRNA
16239168, 15963342
Chloroform
  • Chloroform results in decreased expression of ACADM mRNA
17522070
Clofibrate
  • Clofibrate results in increased expression of ACADM mRNA
17522070
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ACADM mRNA
17602206
Dexamethasone
  • Dexamethasone results in decreased expression of ACADM mRNA
17522070
Dietary Fats
  • Dietary Fats results in decreased expression of ACADM mRNA
18367378
Dietary Fats
  • Dietary Fats results in increased expression of ACADM mRNA
18042831
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ACADM mRNA
17602206
Erythromycin Estolate
  • Erythromycin Estolate results in decreased expression of ACADM mRNA
17522070
Estradiol
  • Estradiol results in decreased expression of ACADM mRNA
14664709
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ACADM mRNA
  • Ethinyl Estradiol results in decreased expression of ACADM mRNA
16174780
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ACADM mRNA
12075121
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ACADM mRNA
17555576
Flavonoids
  • Flavonoids results in increased expression of ACADM mRNA
18035473
Ketone Bodies
  • Ketone Bodies results in decreased expression of ACADM mRNA
16807920
lipopolysaccharide A
  • lipopolysaccharide A inhibits the reaction [ESRRA protein binds to ACADM promoter]
  • lipopolysaccharide A results in decreased activity of ACADM protein
  • lipopolysaccharide A results in decreased expression of ACADM mRNA
16061943
Methylmercury Compounds
  • Methylmercury Compounds results in increased expression of ACADM mRNA
16966085
palm oil
  • palm oil results in increased expression of ACADM mRNA
18042831
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACADM mRNA
16221955
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACADM mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ACADM mRNA
18301758, 15375163, 17426115
Quinidine
  • Quinidine results in decreased expression of ACADM mRNA
17522070
Tamoxifen
  • Tamoxifen affects the expression of ACADM mRNA
17555576
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in decreased expression of ACADM mRNA
15703262
Tetracycline
  • Tetracycline results in decreased expression of ACADM mRNA
17522070
Theophylline
  • Theophylline results in decreased expression of ACADM mRNA
17522070
Turpentine
  • Turpentine results in decreased expression of ACADM mRNA
16061943
Zymosan
  • Zymosan results in decreased expression of ACADM mRNA
16061943

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ACYL-CoA DEHYDROGENASE, MEDIUM-CHAIN, DEFICIENCY OF marker
Acute-Phase Reaction inferred via Turpentine 16044259
Infertility, Male inferred via Theophylline 16988215
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Breast Neoplasms inferred via Tamoxifen 16202921, 15565566, 11161223, 17261762, 17440819, 15668708, 17893378, 17049068, 16873071, 16818667, 17242785
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Dementia inferred via Methylmercury Compounds 16140633
Inflammation inferred via Flavonoids 17296493
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 11677210, 15861022, 16105132, 17333356, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 18497071, 17018787, 17261762, 12948864
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 16891317, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Hepatitis, Toxic inferred via Erythromycin Estolate 17522070
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 11831363, 10672840, 10737359, 17428255
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 15885732, 12112319, 10737359, 18648771, 16942905
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 16842330, 3124819
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Liver Neoplasms inferred via Clofibric Acid 17602206
Dyslipidemias inferred via Clofibrate 16707586
Niemann-Pick Disease, Type C inferred via Clofibrate 9802331
Hepatitis, Toxic inferred via Chloroform 3104120, 17522070
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15700767, 10355542, 16011737, 16097048, 15673190, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 12631006, 61145, 12795759, 15959796, 16239168, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15998439, 16227642, 15027814, 15968718, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 17334410, 16239168
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 17525996, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 18376398, 12389079, 18187930, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 16248980, 16116963, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16644109, 16289102
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 16227642, 16177239, 14986274, 17562736, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Purevsuren J, et al. (2009) "A novel molecular aspect of Japanese patients with medium-chain acyl-CoA dehydrogenase deficiency (MCADD): c.449-452delCTGA is a common mutation in Japanese patients with MCADD." Mol Genet Metab. 96(2):77-79. PMID:19064330
  2. [ + ] Khalid JM, et al. (2008) "Ethnicity of children with homozygous c.985A>G medium-chain acyl-CoA dehydrogenase deficiency: findings from screening approximately 1.1 million newborn infants." J Med Screen. 15(3):112-117. PMID:18927092
  3. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  4. [ + ] Nichols MJ, et al. (2008) "Novel mutations causing medium chain acyl-CoA dehydrogenase deficiency: under-representation of the common c.985 A > G mutation in the New York state population." Am J Med Genet A. 146A(5):610-619. PMID:18241067
  5. [ + ] Derks TG, et al. (2008) "Neonatal screening for medium-chain acyl-CoA dehydrogenase (MCAD) deficiency in The Netherlands: the importance of enzyme analysis to ascertain true MCAD deficiency." J Inherit Metab Dis. 31(1):88-96. PMID:18188679
  6. [ + ] Santos L, et al. (2007) "Acute liver failure in pregnancy associated with maternal MCAD deficiency." J Inherit Metab Dis. 30(1):103. PMID:17186412
  7. [ + ] Giroux S, et al. (2007) "Assessment of the prevalence of the 985A>G MCAD mutation in the French-Canadian population using allele-specific PCR." Clin Genet. 71(6):569-575. PMID:17539907
  8. [ + ] Grosse SD, et al. (2006) "The epidemiology of medium chain acyl-CoA dehydrogenase deficiency: an update." Genet Med. 8(4):205-212. PMID:16617240
  9. [ + ] Maydan G, et al. (2006) "TAT gene mutation analysis in three Palestinian kindreds with oculocutaneous tyrosinaemia type II; characterization of a silent exonic transversion that causes complete missplicing by exon 11 skipping." J Inherit Metab Dis. 29(5):620-626. PMID:16917729
  10. [ + ] Waddell L, et al. (2006) "Medium-chain acyl-CoA dehydrogenase deficiency: genotype-biochemical phenotype correlations." Mol Genet Metab. 87(1):32-39. PMID:16291504
  11. [ + ] Nennstiel-Ratzel U, et al. (2005) "Reduced incidence of severe metabolic crisis or death in children with medium chain acyl-CoA dehydrogenase deficiency homozygous for c.985A>G identified by neonatal screening." Mol Genet Metab. 85(2):157-159. PMID:15896661
  12. [ + ] Guo D, et al. (2005) "Proteomic analysis of SUMO4 substrates in HEK293 cells under serum starvation-induced stress." Biochem Biophys Res Commun. 337(4):1308-1318. PMID:16236267
  13. [ + ] O'Reilly LP, et al. (2005) "Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD). K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein." FEBS J. 272(17):4549-4557. PMID:16128823
  14. [ + ] Blois B, et al. (2005) "Newborns with C8-acylcarnitine level over the 90th centile have an increased frequency of the common MCAD 985A>G mutation." J Inherit Metab Dis. 28(4):551-556. PMID:15902558
  15. [ + ] Maier EM, et al. (2005) "Population spectrum of ACADM genotypes correlated to biochemical phenotypes in newborn screening for medium-chain acyl-CoA dehydrogenase deficiency." Hum Mutat. 25(5):443-452. PMID:15832312
  16. [ + ] Korman SH, et al. (2004) "Homozygosity for a severe novel medium-chain acyl-CoA dehydrogenase (MCAD) mutation IVS3-1G > C that leads to introduction of a premature termination codon by complete missplicing of the MCAD mRNA and is associated with phenotypic diversity ranging from sudden neonatal death to asymptomatic status." Mol Genet Metab. 82(2):121-129. PMID:15171999
  17. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  18. [ + ] Lehotay DC, et al. (2004) "Blood acylcarnitine levels in normal newborns and heterozygotes for medium-chain acyl-CoA dehydrogenase deficiency: a relationship between genotype and biochemical phenotype?" J Inherit Metab Dis. 27(1):81-88. PMID:14970748
  19. [ + ] Schreiber SN, et al. (2003) "The transcriptional coactivator PGC-1 regulates the expression and activity of the orphan nuclear receptor estrogen-related receptor alpha (ERRalpha)." J Biol Chem. 278(11):9013-9018. PMID:12522104
  20. [ + ] Parker AR, et al. (2003) "Binding of the human "electron transferring flavoprotein" (ETF) to the medium chain acyl-CoA dehydrogenase (MCAD) involves an arginine and histidine residue." J Enzyme Inhib Med Chem. 18(5):453-462. PMID:14692513
  21. [ + ] Maehara K, et al. (2003) "Functional interference between estrogen-related receptor alpha and peroxisome proliferator-activated receptor alpha/9-cis-retinoic acid receptor alpha heterodimer complex in the nuclear receptor response element-1 of the medium chain acyl-coenzyme A dehydrogenase gene." J Mol Endocrinol. 31(1):47-60. PMID:12914524
  22. [ + ] Hanley PJ, et al. (2003) "Beta-oxidation of 5-hydroxydecanoate, a putative blocker of mitochondrial ATP-sensitive potassium channels." J Physiol. 547(Pt 2):387-393. PMID:12562916
  23. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  24. [ + ] Andresen BS, et al. (2001) "Medium-chain acyl-CoA dehydrogenase (MCAD) mutations identified by MS/MS-based prospective screening of newborns differ from those observed in patients with clinical symptoms: identification and characterization of a new, prevalent mutation that results in mild MCAD deficiency." Am J Hum Genet. 68(6):1408-1418. PMID:11349232
  25. [ + ] Zschocke J, et al. (2001) "Molecular and functional characterisation of mild MCAD deficiency." Hum Genet. 108(5):404-408. PMID:11409868
  26. [ + ] Albers S, et al. (2001) "Compound heterozygosity in four asymptomatic siblings with medium-chain acyl-CoA dehydrogenase deficiency." J Inherit Metab Dis. 24(3):417-418. PMID:11486912
  27. [ + ] Carpenter K, et al. (2001) "Evaluation of newborn screening for medium chain acyl-CoA dehydrogenase deficiency in 275 000 babies." Arch Dis Child Fetal Neonatal Ed. 85(2):F105-F109. PMID:11517203
  28. [ + ] Yang BZ, et al. (2000) "Identification of a novel mutation in patients with medium-chain acyl-CoA dehydrogenase deficiency." Mol Genet Metab. 69(3):259-262. PMID:10767181
  29. [ + ] Wang SS, et al. (1999) "Medium chain acyl-CoA dehydrogenase deficiency human genome epidemiology review." Genet Med. 1(7):332-339. PMID:11263545
  30. [ + ] Kuchler B, et al. (1999) "Biochemical characterization of a variant human medium-chain acyl-CoA dehydrogenase with a disease-associated mutation localized in the active site." Biochem J. 337 ( Pt 2)():225-230. PMID:9882619
  31. [ + ] Battaile KP, et al. (1998) "Human long chain, very long chain and medium chain acyl-CoA dehydrogenases are specific for the S-enantiomer of 2- methylpentadecanoyl-CoA." Biochim Biophys Acta. 1390(3):333-338. PMID:9487154
  32. [ + ] Peterson KL, et al. (1998) "Influence of excision of a methylene group from Glu-376 (Glu376-->Asp mutation) in the medium chain acyl-CoA dehydrogenase-catalyzed reaction." Biochemistry. 37(6):1697-1705. PMID:9484241
  33. [ + ] Andresen BS, et al. (1997) "The molecular basis of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency in compound heterozygous patients: is there correlation between genotype and phenotype?" Hum Mol Genet. 6(5):695-707. PMID:9158144
  34. [ + ] Lee HJ, et al. (1996) "Crystal structures of the wild type and the Glu376Gly/Thr255Glu mutant of human medium-chain acyl-CoA dehydrogenase: influence of the location of the catalytic base on substrate specificity." Biochemistry. 35(38):12412-12420. PMID:8823176
  35. [ + ] Leone TC, et al. (1995) "The human medium chain Acyl-CoA dehydrogenase gene promoter consists of a complex arrangement of nuclear receptor response elements and Sp1 binding sites." J Biol Chem. 270(27):16308-16314. PMID:7608198
  36. [ + ] Ziadeh R, et al. (1995) "Medium chain acyl-CoA dehydrogenase deficiency in Pennsylvania: neonatal screening shows high incidence and unexpected mutation frequencies." Pediatr Res. 37(5):675-678. PMID:7603790
  37. [ + ] Brackett JC, et al. (1994) "A novel mutation in medium chain acyl-CoA dehydrogenase causes sudden neonatal death." J Clin Invest. 94(4):1477-1483. PMID:7929823
  38. [ + ] Andresen BS, et al. (1994) "Disease-causing mutations in exon 11 of the medium-chain acyl-CoA dehydrogenase gene." Am J Hum Genet. 54(6):975-988. PMID:8198141
  39. [ + ] Zhang ZF, et al. (1992) "Structural organization and regulatory regions of the human medium-chain acyl-CoA dehydrogenase gene." Biochemistry. 31(1):81-89. PMID:1731887
  40. [ + ] Tanaka K, et al. (1992) "Mutations in the medium chain acyl-CoA dehydrogenase (MCAD) gene." Hum Mutat. 1(4):271-279. PMID:1363805
  41. [ + ] Ding JH, et al. (1992) "Identification of a new mutation in medium-chain acyl-CoA dehydrogenase (MCAD) deficiency." Am J Hum Genet. 50(1):229-233. PMID:1729890
  42. [ + ] Yokota I, et al. (1991) "Molecular survey of a prevalent mutation, 985A-to-G transition, and identification of five infrequent mutations in the medium-chain Acyl-CoA dehydrogenase (MCAD) gene in 55 patients with MCAD deficiency." Am J Hum Genet. 49(6):1280-1291. PMID:1684086
  43. [ + ] Kolvraa S, et al. (1991) "The most common mutation causing medium-chain acyl-CoA dehydrogenase deficiency is strongly associated with a particular haplotype in the region of the gene." Hum Genet. 87(4):425-428. PMID:1679031
  44. [ + ] Blakemore AI, et al. (1991) "Frequency of the G985 MCAD mutation in the general population." Lancet. 337(8736):298-299. PMID:1671131
  45. [ + ] Gregersen N, et al. (1991) "Molecular characterization of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency: identification of a lys329 to glu mutation in the MCAD gene, and expression of inactive mutant enzyme protein in E. coli." Hum Genet. 86(6):545-551. PMID:1902818
  46. [ + ] Matsubara Y, et al. (1990) "Identification of a common mutation in patients with medium-chain acyl-CoA dehydrogenase deficiency." Biochem Biophys Res Commun. 171(1):498-505. PMID:2393404
  47. [ + ] Kelly DP, et al. (1990) "Molecular characterization of inherited medium-chain acyl-CoA dehydrogenase deficiency." Proc Natl Acad Sci U S A. 87(23):9236-9240. PMID:2251268
  48. [ + ] Yokota I, et al. (1990) "Molecular basis of medium chain acyl-coenzyme A dehydrogenase deficiency. An A to G transition at position 985 that causes a lysine-304 to glutamate substitution in the mature protein is the single prevalent mutation." J Clin Invest. 86(3):1000-1003. PMID:2394825
  49. [ + ] Kelly DP, et al. (1987) "Nucleotide sequence of medium-chain acyl-CoA dehydrogenase mRNA and its expression in enzyme-deficient human tissue." Proc Natl Acad Sci U S A. 84(12):4068-4072. PMID:3035565
  50. [ + ] Finocchiaro G, et al. (1987) "Purification and properties of short chain acyl-CoA, medium chain acyl-CoA, and isovaleryl-CoA dehydrogenases from human liver." J Biol Chem. 262(17):7982-7989. PMID:3597357