abcf2 | GeneID:336770 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 336770 Official Symbol abcf2
Locus N/A Gene Type protein-coding
Synonyms fc74f03; fd58d07; wu:fb04f06; wu:fc74f03; wu:fd58d07
Full Name ATP-binding cassette, sub-family F (GCN20), member 2
Description ATP-binding cassette, sub-family F (GCN20), member 2
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21408

ID Symbol Protein Species
GeneID:10061 ABCF2 NP_005683.2 Homo sapiens
GeneID:27407 Abcf2 NP_038881.1 Mus musculus
GeneID:32508 CG9281 NP_573057.1 Drosophila melanogaster
GeneID:176771 abcf-2 NP_499779.1 Caenorhabditis elegans
GeneID:311959 Abcf2 XP_231307.1 Rattus norvegicus
GeneID:336770 abcf2 NP_958472.1 Danio rerio
GeneID:426038 ABCF2 NP_001006562.1 Gallus gallus
GeneID:463887 ABCF2 XP_001139777.1 Pan troglodytes
GeneID:482806 ABCF2 XP_850220.1 Canis lupus familiaris
GeneID:513061 ABCF2 NP_001039601.1 Bos taurus
GeneID:836200 ATGCN1 NP_200887.1 Arabidopsis thaliana
GeneID:1273267 AgaP_AGAP002693 XP_312228.2 Anopheles gambiae
GeneID:4346343 Os08g0564100 NP_001062528.1 Oryza sativa
GeneID:4347924 Os09g0572400 NP_001063997.1 Oryza sativa
GeneID:100000576 LOC100000576 XP_001337123.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_201315 NP_958472

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000056640 MI0003343 dre-let-7j UGAGGUAGUUGUUUGUACAGUU
ENSDART00000056640 MI0001897 dre-miR-17a* ACUGCAGUGGAGGCACUUCUAG
ENSDART00000056640 MI0002040 dre-miR-202* UUCCUAUGCAUAUACCUCUUUG
ENSDART00000056640 MI0001907 dre-miR-20a* ACUGCAGUGUGAGCACUUGAAG
ENSDART00000056640 MI0001365 dre-miR-34 UGGCAGUGUCUUAGCUGGUUGU
ENSDART00000056640 MI0004767 dre-miR-723* GACAGUUUUAAAUGAUGUUACUUU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

AAH47181   AAH66505   AAI65771   NP_958472   Q6NYQ1   Q802V8  

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Annilo T, et al. (2006) "Evolution of the vertebrate ABC gene family: analysis of gene birth and death." Genomics. 88(1):1-11. PMID:16631343
  2. [ + ] Dean M, et al. (2005) "Evolution of the ATP-binding cassette (ABC) transporter superfamily in vertebrates." Annu Rev Genomics Hum Genet. 6():123-142. PMID:16124856
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  4. [ + ] Woods IG, et al. (2000) "A comparative map of the zebrafish genome." Genome Res. 10(12):1903-1914. PMID:11116086