ACADL | GeneID:33 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 33 Official Symbol ACADL
Locus N/A Gene Type protein-coding
Synonyms ACAD4; FLJ94052; LCAD
Full Name acyl-Coenzyme A dehydrogenase, long chain
Description acyl-Coenzyme A dehydrogenase, long chain
Chromosome 2q34-q35
Also Known As long-chain acyl-CoA dehydrogenase
Summary The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family, which is a family of mitochondrial flavoenzymes involved in fatty acid and branched chain amino-acid metabolism. This protein is one of the four enzymes that catalyze the initial step of mitochondrial beta-oxidation of straight-chain fatty acid. Defects in this gene are the cause of long-chain acyl-CoA dehydrogenase (LCAD) deficiency, leading to nonketotic hypoglycemia. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37498

ID Symbol Protein Species
GeneID:33 ACADL NP_001599.1 Homo sapiens
GeneID:11363 Acadl NP_031407.2 Mus musculus
GeneID:25287 Acadl NP_036951.1 Rattus norvegicus
GeneID:394156 acadl NP_957475.1 Danio rerio
GeneID:424005 ACADL NP_001006511.1 Gallus gallus
GeneID:459914 ACADL XP_516063.2 Pan troglodytes
GeneID:478895 ACADL XP_536053.2 Canis lupus familiaris
GeneID:614508 ACADL NP_001070404.1 Bos taurus
GeneID:100150734 LOC100150734 XP_001922695.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA011990 Anti-ACADL antibody produced in rabbit ;
2 sigma HPA010611 Anti-ACADL antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACADL Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACADL Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0009055 Function electron carrier activity
GO:0050660 Function FAD binding
GO:0004466 Function long-chain-acyl-CoA dehydrogenase activity
GO:0006631 Process fatty acid metabolic process
GO:0006629 Process lipid metabolic process
GO:0055114 Process oxidation reduction

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001608  UCSC Browser NP_001599

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000233710 MI0000113 hsa-miR-106a* CUGCAAUGUAAGCACUUCUUAC
ENST00000233710 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000233710 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000233710 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000233710 MI0000650 hsa-miR-200c* CGUCUUACCCAGCAGUGUUUGG
ENST00000233710 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000233710 MI0000089 hsa-miR-31 AGGCAAGAUGCUGGCAUAGCU
ENST00000233710 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000233710 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000233710 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000233710 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000233710 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENST00000233710 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000233710 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000233710 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENST00000233710 MI0003656 hsa-miR-641 AAAGACAUAGGAUAGAGUCACCUC
ENST00000233710 MI0000263 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000233710 MI0000264 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000233710 MI0000265 hsa-miR-7 UGGAAGACUAGUGAUUUUGUUGU
ENST00000233710 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000233710 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000233710 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000233710 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000233710 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENST00000233710 MI0005206 mmu-miR-742 GAAAGCCACCAUGCUGGGUAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Dietary Fats
  • Dietary Fats results in increased expression of ACADL mRNA
16357043
Diethylnitrosamine
  • Diethylnitrosamine results in decreased expression of ACADL mRNA
11323195
Doxorubicin
  • Doxorubicin results in decreased expression of ACADL protein
  • [Doxorubicin co-treated with MT2A protein] results in decreased expression of ACADL protein
16144979
Ethylnitrosourea
  • Ethylnitrosourea results in increased expression of ACADL mRNA
15954086
Fluorouracil
  • Fluorouracil results in increased expression of ACADL protein
15585135
Methapyrilene
  • Methapyrilene results in decreased expression of ACADL mRNA
16393664
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ACADL mRNA
17681415
pirinixic acid
  • pirinixic acid results in increased expression of ACADL mRNA
18301758, 17426115, 15375163, 16357043

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ACYL-CoA DEHYDROGENASE, LONG-CHAIN, DEFICIENCY OF marker
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Liver Neoplasms inferred via Methapyrilene 15890375
Breast Neoplasms inferred via Fluorouracil 15136595
Carcinoid Tumor inferred via Fluorouracil 16051944
Colonic Neoplasms inferred via Fluorouracil 17725105
Colorectal Neoplasms inferred via Fluorouracil 17594712, 17255274, 17695437, 17401013, 16303861, 17454858
Brain Diseases inferred via Ethylnitrosourea 14991843
Brain Neoplasms inferred via Ethylnitrosourea 16651633, 16436596, 18412241, 16357521, 15144691
Cell Transformation, Neoplastic inferred via Ethylnitrosourea 16003739
Central Nervous System Neoplasms inferred via Ethylnitrosourea 17160924
Ectodermal Dysplasia inferred via Ethylnitrosourea 18357618
Glioblastoma inferred via Ethylnitrosourea 16436596
Glioma inferred via Ethylnitrosourea 16651633, 18412241, 16357521
Kidney Neoplasms inferred via Ethylnitrosourea 17379185
Lung Neoplasms inferred via Ethylnitrosourea 16271038, 17703301, 16019985
Lymphoma inferred via Ethylnitrosourea 15790496
Mammary Neoplasms, Experimental inferred via Ethylnitrosourea 10838139, 10767621, 18041768
Meningioma inferred via Ethylnitrosourea 17943659
Neoplasms, Experimental inferred via Ethylnitrosourea 16707424
Neurilemmoma inferred via Ethylnitrosourea 17160924, 16003739, 16651423
Oligodendroglioma inferred via Ethylnitrosourea 17160924
Thymus Neoplasms inferred via Ethylnitrosourea 15790496
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 17426702, 18382427, 17369602, 16264153, 15994142, 15634643, 15136595, 11325840, 16322301, 16096432, 15993339, 15567936, 15668708, 18234424, 16935488, 18628466, 16826403, 17983394
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16234567, 17876044, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 15811867, 17382496, 17308081, 17007740, 17974986, 17329180, 16455267, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 18627295, 16731534
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16144979, 16244372, 16879835, 16330681, 16244371
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16729912, 16868541, 15749863, 18437689, 16888761
Sarcoma inferred via Doxorubicin 18313854, 16767912, 17203757, 15675481, 15625365, 17710206
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 15625365, 17203757
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 10672840, 17428255, 11831363, 10737359
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 15885732, 18648771, 10737359, 16942905, 12112319
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  3. [ + ] Lea W, et al. (2000) "Long-chain acyl-CoA dehydrogenase is a key enzyme in the mitochondrial beta-oxidation of unsaturated fatty acids." Biochim Biophys Acta. 1485(2-3):121-128. PMID:10832093
  4. [ + ] Wanders RJ, et al. (1998) "2,6-Dimethylheptanoyl-CoA is a specific substrate for long-chain acyl-CoA dehydrogenase (LCAD): evidence for a major role of LCAD in branched-chain fatty acid oxidation." Biochim Biophys Acta. 1393(1):35-40. PMID:9714723
  5. [ + ] Zhang Z, et al. (1997) "Regulation of the human long chain acyl-CoA dehydrogenase gene by nuclear hormone receptor transcription factors." Biochim Biophys Acta. 1350(1):53-64. PMID:9003458
  6. [ + ] Costa CG, et al. (1996) "Organic acid profiles resembling a beta-oxidation defect in two patients with coeliac disease." J Inherit Metab Dis. 19(2):177-180. PMID:8739959
  7. [ + ] Indo Y, et al. (1992) "Molecular cloning and nucleotide sequence of cDNAs encoding human long chain acyl-CoA dehydrogenase and assignment of its gene to chromosome 2." Prog Clin Biol Res. 375():161-167. PMID:1438359
  8. [ + ] Indo Y, et al. (1992) "Molecular cloning and nucleotide sequence of cDNAs encoding human long-chain acyl-CoA dehydrogenase and assignment of the location of its gene (ACADL) to chromosome 2." Genomics. 12(3):626. PMID:1559716
  9. [ + ] Abe T, et al. (1992) "Human long-chain acyl-CoA synthetase: structure and chromosomal location." J Biochem. 111(1):123-128. PMID:1607358
  10. [ + ] Treem WR, et al. (1991) "Hypoglycemia, hypotonia, and cardiomyopathy: the evolving clinical picture of long-chain acyl-CoA dehydrogenase deficiency." Pediatrics. 87(3):328-333. PMID:2000272
  11. [ + ] Indo Y, et al. (1991) "Immunochemical characterization of variant long-chain acyl-CoA dehydrogenase in cultured fibroblasts from nine patients with long-chain acyl-CoA dehydrogenase deficiency." Pediatr Res. 30(3):211-215. PMID:1945557
  12. [ + ] Indo Y, et al. (1991) "Molecular cloning and nucleotide sequence of cDNAs encoding human long-chain acyl-CoA dehydrogenase and assignment of the location of its gene (ACADL) to chromosome 2." Genomics. 11(3):609-620. PMID:1774065
  13. [ + ] Hale DE, et al. (1985) "Long-chain acyl coenzyme A dehydrogenase deficiency: an inherited cause of nonketotic hypoglycemia." Pediatr Res. 19(7):666-671. PMID:4022672