ACADL | GeneID:33 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 33 | Official Symbol | ACADL |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | ACAD4; FLJ94052; LCAD | ||
| Full Name | acyl-Coenzyme A dehydrogenase, long chain | ||
| Description | acyl-Coenzyme A dehydrogenase, long chain | ||
| Chromosome | 2q34-q35 | ||
| Also Known As | long-chain acyl-CoA dehydrogenase | ||
| Summary | The protein encoded by this gene belongs to the acyl-CoA dehydrogenase family, which is a family of mitochondrial flavoenzymes involved in fatty acid and branched chain amino-acid metabolism. This protein is one of the four enzymes that catalyze the initial step of mitochondrial beta-oxidation of straight-chain fatty acid. Defects in this gene are the cause of long-chain acyl-CoA dehydrogenase (LCAD) deficiency, leading to nonketotic hypoglycemia. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37498
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:33 | ACADL | NP_001599.1 | Homo sapiens |
| GeneID:11363 | Acadl | NP_031407.2 | Mus musculus |
| GeneID:25287 | Acadl | NP_036951.1 | Rattus norvegicus |
| GeneID:394156 | acadl | NP_957475.1 | Danio rerio |
| GeneID:424005 | ACADL | NP_001006511.1 | Gallus gallus |
| GeneID:459914 | ACADL | XP_516063.2 | Pan troglodytes |
| GeneID:478895 | ACADL | XP_536053.2 | Canis lupus familiaris |
| GeneID:614508 | ACADL | NP_001070404.1 | Bos taurus |
| GeneID:100150734 | LOC100150734 | XP_001922695.1 | Danio rerio |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005759 | Component | mitochondrial matrix |
| GO:0005739 | Component | mitochondrion |
| GO:0009055 | Function | electron carrier activity |
| GO:0050660 | Function | FAD binding |
| GO:0004466 | Function | long-chain-acyl-CoA dehydrogenase activity |
| GO:0006631 | Process | fatty acid metabolic process |
| GO:0006629 | Process | lipid metabolic process |
| GO:0055114 | Process | oxidation reduction |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000233710 | MI0000113 | hsa-miR-106a* | CUGCAAUGUAAGCACUUCUUAC |
| ENST00000233710 | MI0000454 | hsa-miR-137 | UUAUUGCUUAAGAAUACGCGUAG |
| ENST00000233710 | MI0000458 | hsa-miR-142-3p | UGUAGUGUUUCCUACUUUAUGGA |
| ENST00000233710 | MI0003137 | hsa-miR-193b* | CGGGGUUUUGAGGGCGAGAUGA |
| ENST00000233710 | MI0000650 | hsa-miR-200c* | CGUCUUACCCAGCAGUGUUUGG |
| ENST00000233710 | MI0000082 | hsa-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENST00000233710 | MI0000089 | hsa-miR-31 | AGGCAAGAUGCUGGCAUAGCU |
| ENST00000233710 | MI0001729 | hsa-miR-451 | AAACCGUUACCAUUACUGAGUU |
| ENST00000233710 | MI0003170 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENST00000233710 | MI0003173 | hsa-miR-518a-5p | CUGCAAAGGGAAGCCCUUUC |
| ENST00000233710 | MI0003612 | hsa-miR-548a-5p | AAAAGUAAUUGCGAGUUUUACC |
| ENST00000233710 | MI0003596 | hsa-miR-548b-5p | AAAAGUAAUUGUGGUUUUGGCC |
| ENST00000233710 | MI0003668 | hsa-miR-548d-3p | CAAAAACCACAGUUUCUUUUGC |
| ENST00000233710 | MI0003671 | hsa-miR-548d-3p | CAAAAACCACAGUUUCUUUUGC |
| ENST00000233710 | MI0003576 | hsa-miR-569 | AGUUAAUGAAUCCUGGAAAGU |
| ENST00000233710 | MI0003656 | hsa-miR-641 | AAAGACAUAGGAUAGAGUCACCUC |
| ENST00000233710 | MI0000263 | hsa-miR-7 | UGGAAGACUAGUGAUUUUGUUGU |
| ENST00000233710 | MI0000264 | hsa-miR-7 | UGGAAGACUAGUGAUUUUGUUGU |
| ENST00000233710 | MI0000265 | hsa-miR-7 | UGGAAGACUAGUGAUUUUGUUGU |
| ENST00000233710 | MI0005543 | hsa-miR-708* | CAACUAGACUGUGAGCUUCUAG |
| ENST00000233710 | MI0000093 | hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENST00000233710 | MI0000094 | hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENST00000233710 | MI0003560 | hsa-miR-92b | UAUUGCACUCGUCCCGGCCUCC |
| ENST00000233710 | MI0004687 | mmu-miR-703 | AAAACCUUCAGAAGGAAAGAA |
| ENST00000233710 | MI0005206 | mmu-miR-742 | GAAAGCCACCAUGCUGGGUAAA |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| Dietary Fats | |
|
|
| Diethylnitrosamine | |
|
|
| Doxorubicin | |
|
|
| Ethylnitrosourea | |
|
|
| Fluorouracil | |
|
|
| Methapyrilene | |
|
|
| perfluorooctanoic acid | |
|
|
| pirinixic acid | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Lea W, et al. (2000) "Long-chain acyl-CoA dehydrogenase is a key enzyme in the mitochondrial beta-oxidation of unsaturated fatty acids." Biochim Biophys Acta. 1485(2-3):121-128. PMID:10832093 - [
] Wanders RJ, et al. (1998) "2,6-Dimethylheptanoyl-CoA is a specific substrate for long-chain acyl-CoA dehydrogenase (LCAD): evidence for a major role of LCAD in branched-chain fatty acid oxidation." Biochim Biophys Acta. 1393(1):35-40. PMID:9714723 - [
] Zhang Z, et al. (1997) "Regulation of the human long chain acyl-CoA dehydrogenase gene by nuclear hormone receptor transcription factors." Biochim Biophys Acta. 1350(1):53-64. PMID:9003458 - [
] Costa CG, et al. (1996) "Organic acid profiles resembling a beta-oxidation defect in two patients with coeliac disease." J Inherit Metab Dis. 19(2):177-180. PMID:8739959 - [
] Indo Y, et al. (1992) "Molecular cloning and nucleotide sequence of cDNAs encoding human long chain acyl-CoA dehydrogenase and assignment of its gene to chromosome 2." Prog Clin Biol Res. 375():161-167. PMID:1438359 - [
] Indo Y, et al. (1992) "Molecular cloning and nucleotide sequence of cDNAs encoding human long-chain acyl-CoA dehydrogenase and assignment of the location of its gene (ACADL) to chromosome 2." Genomics. 12(3):626. PMID:1559716 - [
] Abe T, et al. (1992) "Human long-chain acyl-CoA synthetase: structure and chromosomal location." J Biochem. 111(1):123-128. PMID:1607358 - [
] Treem WR, et al. (1991) "Hypoglycemia, hypotonia, and cardiomyopathy: the evolving clinical picture of long-chain acyl-CoA dehydrogenase deficiency." Pediatrics. 87(3):328-333. PMID:2000272 - [
] Indo Y, et al. (1991) "Immunochemical characterization of variant long-chain acyl-CoA dehydrogenase in cultured fibroblasts from nine patients with long-chain acyl-CoA dehydrogenase deficiency." Pediatr Res. 30(3):211-215. PMID:1945557 - [
] Indo Y, et al. (1991) "Molecular cloning and nucleotide sequence of cDNAs encoding human long-chain acyl-CoA dehydrogenase and assignment of the location of its gene (ACADL) to chromosome 2." Genomics. 11(3):609-620. PMID:1774065 - [
] Hale DE, et al. (1985) "Long-chain acyl coenzyme A dehydrogenase deficiency: an inherited cause of nonketotic hypoglycemia." Pediatr Res. 19(7):666-671. PMID:4022672
The known genetic variants determining plasma HDL cholesterol (HDL-C) levels explain only part of its variation. Three hundred eighty-four single nucleotide polymorphisms (SNPs) across 251 genes based on pathways potentially relevant to HDL-C metabolism were selected and genotyped in 3,575 subjects from the Doetinchem cohort, which was examined thrice over 11 years. Three hundred fifty-three SNPs in 239 genes passed the quality-control criteria. Seven SNPs [rs1800777 and rs5882 in cholesteryl ester transfer protein (CETP); rs3208305, rs328, and rs268 in LPL; rs1800588 in LIPC; rs2229741 in NRIP1] were associated with plasma HDL-C levels with false discovery rate (FDR) adjusted q values (FDR_q) < 0.05. Five other SNPs (rs17585739 in SC4MOL, rs11066322 in PTPN11, rs4961 in ADD1, rs6060717 near SCAND1, and rs3213451 in MBTPS2 in women) were associated with plasma HDL-C levels with FDR_q between 0.05 and 0.2. Two less well replicated associations (rs3135506 in APOA5 and rs1800961 in HNF4A) known from the literature were also observed, but their significance disappeared after adjustment for multiple testing (P = 0.008, FDR_q = 0.221 for rs3135506; P = 0.018, FDR_q = 0.338 for rs1800961, respectively). In addition to replication of previous results for candidate genes (CETP, LPL, LIPC, HNF4A, and APOA5), we found interesting new candidate SNPs (rs2229741 in NRIP1, rs3213451 in MBTPS2, rs17585739 in SC4MOL, rs11066322 in PTPN11, rs4961 in ADD1, and rs6060717 near SCAND1) for plasma HDL-C levels that should be evaluated further.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The first reaction of mitochondrial beta-oxidation, which is catalyzed by acyl-CoA dehydrogenases, was studied with unsaturated fatty acids that have a double bond either at the 4,5 or 5,6 position. The CoA thioesters of docosahexaenoic acid, arachidonic acid, 4,7,10-cis-hexadecatrienoic acid, 5-cis-tetradecenoic acid, and 4-cis-decenoic acid were effectively dehydrogenated by both rat and human long-chain acyl-CoA dehydrogenases (LCAD), whereas they were poor substrates of very long-chain acyl-CoA dehydrogenases (VLCAD). VLCAD, however, was active with CoA derivatives of long-chain saturated fatty acids or unsaturated fatty acids that have double bonds further removed from the thioester function. Although bovine LCAD effectively dehydrogenated 5-cis-tetradecenoyl-CoA (14:1) and 4,7,10-cis-hexadecatrienoyl-CoA, it was nearly inactive toward the other unsaturated substrates. The catalytic efficiency of rat VLCAD with 14:1 as substrate was only 4% of the efficiency determined with tetradecanoyl-CoA, whereas LCAD acted equally well on both substrates. The conclusion of this study is that LCAD serves an important, if not essential function in the beta-oxidation of unsaturated fatty acids.
Oxidation of straight-chain fatty acids in mitochondria involves the complicated interaction between a large variety of different enzymes. So far four different mitochondrial straight-chain acyl-CoA dehydrogenases have been identified. The physiological function of three of the four acyl-CoA dehydrogenases has been resolved in recent years especially from studies on patients suffering from certain inborn errors of mitochondrial fatty acid beta-oxidation. The physiological role of long-chain acyl-CoA dehydrogenase (LCAD) has remained obscure, however. The results described in this paper provide strong evidence suggesting that LCAD plays a central role in branched-chain fatty acid metabolism since it turns out to be the major acyl-CoA dehydrogenase reacting with 2,6-dimethylheptanoyl-CoA, a metabolite of pristanic acid, which itself is the alpha-oxidation product of phytanic acid.
Mitochondrial fatty acid oxidation provides most of the energy required for myocardial function after birth. Long chain acyl-CoA dehydrogenase (LCAD) catalyzes the first step in the beta-oxidation spiral. Our objective was to define regulatory elements of the human LCAD gene required for high levels of expression in mature heart and to locate elements suppressing gene expression in the fetus. We characterized the human LCAD gene structure and used in vitro transfection into cardiomyocytes and hepatoma cells of LCAD genomic fragments fused to a reporter gene to examine the effects of putative regulatory elements on transcription. Binding of transcription factors to nuclear hormone receptor consensus DNA binding domains was studied by gel shift experiments. The 200 bp of the human LCAD gene immediately upstream of the transcription initiation site are sufficient to act as a minimal promoter for the gene and provide some tissue-specific positive regulatory elements. The region from -1800 bp to -250 bp contains elements which markedly suppress transcription, including nuclear hormone receptor response elements. The dominant interaction is with the repressor factor, chicken ovalbumin upstream promoter transcription factor. We conclude that the developmental and tissue-specific regulation of the human LCAD gene is mediated, in part, by these nuclear hormone receptor transcription factors.
A complementary DNA clone encoding the entire human long-chain acyl-CoA synthetase was isolated and the total 698-amino acid sequence was deduced. The amino acid sequence of human long-chain acyl-CoA synthetase shows 84.9% identity to that of rat long-chain acyl-CoA synthetase. The nucleotide sequences of the protein coding regions between human and rat long-chain acyl-CoA synthetase mRNAs are highly conserved (85.6%), whereas those of the 3' untranslated regions are less conserved (72%). The location of the human long-chain acyl-CoA synthetase gene was identified on chromosome 4 by spot hybridization of flow-sorted chromosomes. Computer-assisted homology search revealed a significant similarity of the enzyme with the enzymes of the luciferase family. Based on this similarity, the structure of human long-chain acyl-CoA synthetase can be divided into five domains: the N-terminus, two domains similar to those in enzymes of the luciferase family, a long gap region between the similar domains and the C-terminus.
Inherited defects in fatty acid oxidation, which have been described and diagnosed with increasing frequency in the last decade, are most commonly attributed to a deficiency in the activity of medium-chain acyl-CoA dehydrogenase. Few cases of the related enzyme defect of long-chain acyl-CoA dehydrogenase activity have been reported. An infant with documented long-chain acyl-CoA dehydrogenase deficiency is described with a detailed metabolic profile, long-term clinical follow-up, and response to treatment. This patient is compared with the seven previously published cases of this disorder in order to stress the unique features of the initial presentation, more subtle late manifestations of the disease, and clinical and biochemical differentiation from the more common medium-chain acyl-CoA dehydrogenase deficiency. This report stresses the enlarging spectrum of the clinical presentation and natural history of this defect in fatty acid oxidation.
Long-chain acyl-CoA dehydrogenase (LCAD) deficiency is a disorder of mitochondrial fatty acid oxidation that is characterized by hypoglycemia, muscle weakness, and hepato- and cardiomegaly. To characterize variant LCAD, we first carried out preliminary experiments using pure enzyme preparations. Despite the significant sequence similarity of LCAD to medium-chain acyl-CoA dehydrogenase, the antibody raised against rat LCAD was monospecific for human and rat LCAD and did not cross-react with either human or rat medium-chain acyl-CoA dehydrogenase. Immunoblot analysis of variant LCAD in cultured fibroblasts from nine patients with LCAD deficiency revealed a single LCAD band in all nine LCAD-deficient cell lines. Each variant LCAD was comparable in molecular size and quantity to normal LCAD, suggesting that the LCAD mutation in each of these cell lines is likely to be a point mutation that produces a stable variant LCAD. The uniform nature of variant LCAD suggests that only a single, or at most a few, prevalent point mutations may be found in the majority of LCAD-deficient patients. If this is the case, it should be possible to devise a molecular diagnostic method for LCAD deficiency.
Long-chain acyl-CoA dehydrogenase (LCAD) catalyzes the first reaction of the mitochondrial beta-oxidation of fatty acids. We isolated and sequenced three cDNA clones encoding human LCAD precursor (p). The cDNAs encompass a 2217-base region including 5, 1290, and 922 bases in the 5'-noncoding, coding, and 3'-noncoding regions, respectively, and encodes the entire pLCAD of 430 amino acids (Mr: 47,656). The N-terminus of the mature human LCAD is currently unknown, but 30 (Mr 3221) and 400 amino acids (Mr: 44,435) of the sequence are considered to constitute the leader peptide and mature protein, respectively, in analogy to its rat counterpart. Human pLCAD cDNA shares 85.3 and 83.7% identical residues with rat pLCAD cDNA at the amino acid and nucleotide levels, respectively. At the amino acid level, human pLCAD shares 30.4 to 32.7% identical residues with three other human enzymes in the acyl-CoA dehydrogenase family, sharing 57 perfectly conserved residues among them. The human pLCAD gene is assigned to chromosome 2, bands q34-q35.
Three children from unrelated families presented in early childhood with hypoglycemia and cardiorespiratory arrests associated with fasting. Significant hepatomegaly, cardiomegaly, and hypotonia were present at the time of initial presentation. Ketones were not present in the urine at the time of hypoglycemia in any patient; however, dicarboxylic aciduria was documented in one patient at the time of the acute episode and in two patients during fasting studies. Total plasma carnitine concentration was low with an increased esterified carnitine fraction. These findings suggested a defect in mitochondrial fatty acid oxidation, and specific assays were performed for the acyl coenzyme A (CoA) dehydrogenases. These analyses showed that the activity of the long-chain acyl CoA dehydrogenase was less than 10% of control values in fibroblasts, leukocytes, and liver tissue. Activities of the medium-chain, short-chain, and isovaleryl CoA dehydrogenases were not different from control values. With cultured fibroblasts, CO2 evolution from long-chain fatty acids was significantly reduced, while CO2 evolution from medium-chain and short-chain fatty acids was comparable to control values--findings consistent with a defect early in the beta-oxidation sequence. Studies of acyl CoA dehydrogenase activities in fibroblasts and leukocytes from parents of the patients showed levels of long-chain acyl CoA dehydrogenase activity intermediate between affected and control values and indicated an autosomal recessive form of inheritance of this enzymatic defect.(ABSTRACT TRUNCATED AT 250 WORDS)

