acin1b | GeneID:327495 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 327495 Official Symbol acin1b
Locus N/A Gene Type protein-coding
Synonyms acinus; acinusb; fi14c05; wu:fe06a10; wu:fi14c05
Full Name apoptotic chromatin condensation inducer 1b
Description apoptotic chromatin condensation inducer 1b
Chromosome N/A
Also Known As apoptotic chromatin condensation inducer in the nucleus, b
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22853

ID Symbol Protein Species
GeneID:22985 ACIN1 NP_055792.1 Homo sapiens
GeneID:35173 hkl NP_724153.1 Drosophila melanogaster
GeneID:56215 Acin1 NP_075679.1 Mus musculus
GeneID:172030 cogc-5 NP_491344.1 Caenorhabditis elegans
GeneID:305884 Acin1 XP_240178.3 Rattus norvegicus
GeneID:327495 acin1b XP_694912.3 Danio rerio
GeneID:452792 ACIN1 XP_509847.2 Pan troglodytes
GeneID:480247 ACIN1 XP_858297.1 Canis lupus familiaris
GeneID:534600 ACIN1 XP_614421.3 Bos taurus
GeneID:1280192 AgaP_AGAP009237 XP_320014.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_689820 XP_694912

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000034218 MI0001389 dre-miR-223 UGUCAGUUUGUCAAAUACCCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  3. [ + ] Inohara N, et al. (2000) "Genes with homology to mammalian apoptosis regulators identified in zebrafish." Cell Death Differ. 7(5):509-510. PMID:10917738