aars | GeneID:324940 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 324940 Official Symbol aars
Locus N/A Gene Type protein-coding
Synonyms MGC158129; im:7146712; si:ch211-223o1.6; wu:fc48h07
Full Name alanyl-tRNA synthetase
Description alanyl-tRNA synthetase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 1213

ID Symbol Protein Species
GeneID:16 AARS NP_001596.2 Homo sapiens
GeneID:34156 Aats-ala NP_523511.2 Drosophila melanogaster
GeneID:171985 ars-2 NP_491281.1 Caenorhabditis elegans
GeneID:234734 Aars NP_666329.2 Mus musculus
GeneID:292023 Aars XP_214690.3 Rattus norvegicus
GeneID:324940 aars NP_001037775.1 Danio rerio
GeneID:415668 AARS NP_001005836.1 Gallus gallus
GeneID:454210 AARS XP_001169474.1 Pan troglodytes
GeneID:479656 AARS XP_536788.2 Canis lupus familiaris
GeneID:510933 AARS XP_588170.3 Bos taurus
GeneID:814313 PF13_0354 XP_001350388.1 Plasmodium falciparum
GeneID:841442 ALATS NP_175439.2 Arabidopsis thaliana
GeneID:854513 ALA1 NP_014980.1 Saccharomyces cerevisiae
GeneID:1279087 AgaP_AGAP009701 XP_318757.2 Anopheles gambiae
GeneID:2542031 SPAC23C11.09 NP_593640.1 Schizosaccharomyces pombe
GeneID:2676649 MGG_03607 XP_361064.2 Magnaporthe grisea
GeneID:2713811 NCU02566.1 XP_331765.1 Neurospora crassa
GeneID:2894909 KLLA0F02431g XP_455190.1 Kluyveromyces lactis
GeneID:4348211 Os10g0182000 NP_001064254.1 Oryza sativa
GeneID:4620624 AGOS_ADR363C NP_984459.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0004812 Function aminoacyl-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001044310 NP_001037775

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000100401 MI0001380 dre-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSDART00000100401 MI0002040 dre-miR-202* UUCCUAUGCAUAUACCUCUUUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Link V, et al. (2006) "Proteomics of early zebrafish embryos." BMC Dev Biol. 6():1. PMID:16412219
  2. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  3. [ + ] Mathavan S, et al. (2005) "Transcriptome analysis of zebrafish embryogenesis using microarrays." PLoS Genet. 1(2):260-276. PMID:16132083
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932