aco2 | GeneID:322670 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 322670 Official Symbol aco2
Locus N/A Gene Type protein-coding
Synonyms cb1017; wu:fa10e03; wu:fb69g04; wu:fc20c11
Full Name aconitase 2, mitochondrial
Description aconitase 2, mitochondrial
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 856

ID Symbol Protein Species
GeneID:50 ACO2 NP_001089.1 Homo sapiens
GeneID:11429 Aco2 NP_542364.1 Mus musculus
GeneID:44149 Acon NP_524708.1 Drosophila melanogaster
GeneID:79250 Aco2 NP_077374.2 Rattus norvegicus
GeneID:176121 aco-2 NP_741235.1 Caenorhabditis elegans
GeneID:280976 ACO2 NP_776402.1 Bos taurus
GeneID:322670 aco2 NP_944590.1 Danio rerio
GeneID:374009 ACO2 NP_989519.1 Gallus gallus
GeneID:470193 ACO2 XP_001141262.1 Pan troglodytes
GeneID:474487 ACO2 XP_858303.1 Canis lupus familiaris
GeneID:851013 ACO1 NP_013407.1 Saccharomyces cerevisiae
GeneID:1278105 AgaP_AGAP007852 XP_317642.2 Anopheles gambiae
GeneID:2541450 SPAC24C9.06c NP_594031.1 Schizosaccharomyces pombe
GeneID:2676822 MGG_03521 XP_360978.1 Magnaporthe grisea
GeneID:2713053 NCU02366.1 XP_331142.1 Neurospora crassa
GeneID:2891900 KLLA0C17314g XP_452974.1 Kluyveromyces lactis
GeneID:4620213 AGOS_ADL032W NP_984065.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0051539 Function 4 iron, 4 sulfur cluster binding
GO:0003994 Function aconitate hydratase activity
GO:0008152 Process metabolic process
GO:0006099 Process tricarboxylic acid cycle

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_198908 NP_944590

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000009321 MI0001897 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000009321 MI0001898 dre-miR-17a CAAAGUGCUUACAGUGCAGGUA
ENSDART00000009321 MI0001899 dre-miR-20b CAAAGUGCUCACAGUGCAGGUAG
ENSDART00000009321 MI0001528 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002142 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002143 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002144 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002146 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002147 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002148 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002149 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002150 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002151 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002152 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002153 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002154 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002155 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002156 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002157 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002158 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002166 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002170 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002171 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002172 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002173 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002174 dre-miR-430b AAAGUGCUAUCAAGUUGGGGUAG
ENSDART00000009321 MI0002181 dre-miR-460-3p CACAGCGCAUACAAUGUGGAUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Woods IG, et al. (2005) "The zebrafish gene map defines ancestral vertebrate chromosomes." Genome Res. 15(9):1307-1314. PMID:16109975
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932