HNRNPA2B1 | GeneID:3181 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 3181 Official Symbol HNRNPA2B1
Locus N/A Gene Type protein-coding
Synonyms DKFZp779B0244; FLJ22720; HNRNPA2; HNRNPB1; HNRPA2; HNRPA2B1; HNRPB1; RNPA2; SNRPB1
Full Name heterogeneous nuclear ribonucleoprotein A2/B1
Description heterogeneous nuclear ribonucleoprotein A2/B1
Chromosome 7p15
Also Known As heterogeneous nuclear ribonucleoprotein B1; nuclear ribonucleoprotein particle A2 protein
Summary This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22992

ID Symbol Protein Species
GeneID:3181 HNRNPA2B1 NP_112533.1 Homo sapiens
GeneID:53379 Hnrnpa2b1 NP_058086.2 Mus musculus
GeneID:362361 Hnrnpa2b1 XP_342685.2 Rattus norvegicus
GeneID:420627 RCJMB04_2g17 NP_001026156.1 Gallus gallus
GeneID:463299 HNRNPA2B1 XP_519003.2 Pan troglodytes
GeneID:475260 HNRNPA2B1 XP_864274.1 Canis lupus familiaris
GeneID:507564 HNRNPA2B1 NP_001039440.1 Bos taurus
GeneID:819972 AT3G07810 NP_566321.1 Arabidopsis thaliana
GeneID:4343740 Os07g0584500 NP_001060120.1 Oryza sativa
GeneID:4350986 Os11g0637700 NP_001068335.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab31645 hnRNP A2B1 antibody (ab31645); Rabbit polyclonal to hnRNP A2B1
2 abcam ab64800 hnRNP A2B1 antibody (ab64800); Rabbit polyclonal to hnRNP A2B1
3 abcam ab6102 hnRNP A2B1 antibody [DP3B3] (ab6102); Mouse monoclonal [DP3B3] to hnRNP A2B1
4 acris BM4520 HNRNPA2B1; antibody Ab
5 acris BM4520S HNRNPA2B1; antibody Ab
6 scbt HNRNPA2B1 HNRNPA2B1 Antibody / HNRNPA2B1 Antibodies;
7 sigma R4653 Monoclonal Anti-hnRNP-A2/B1 antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of HNRNPA2B1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of HNRNPA2B1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0030530 Component heterogeneous nuclear ribonucleoprotein complex
GO:0005654 Component nucleoplasm
GO:0005634 Component nucleus
GO:0005681 Component spliceosome
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0003723 Function RNA binding
GO:0043047 Function single-stranded telomeric DNA binding
GO:0000398 Process nuclear mRNA splicing, via spliceosome
GO:0008380 Process RNA splicing
GO:0050658 Process RNA transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_002137  UCSC Browser NP_002128
2 NM_031243  UCSC Browser NP_112533

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000356674 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000356674 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000360787 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000360787 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in decreased expression of HNRNPA2B1 mRNA
12832660
4-hydroxytamoxifen
  • 4-hydroxytamoxifen results in decreased expression of HNRNPA2B1 mRNA
16514628
Butylated Hydroxytoluene
  • [Methylcholanthrene co-treated with Butylated Hydroxytoluene] affects the expression of HNRNPA2B1 protein
17477362
Estradiol
  • Estradiol results in increased expression of HNRNPA2B1 mRNA
16514628
fulvestrant
  • fulvestrant results in decreased expression of HNRNPA2B1 mRNA
16514628
Methylcholanthrene
  • [Methylcholanthrene co-treated with Butylated Hydroxytoluene] affects the expression of HNRNPA2B1 protein
17477362
Paraquat
  • Paraquat results in increased expression of HNRNPA2B1 mRNA alternative form
17064354
Raloxifene
  • Raloxifene results in decreased expression of HNRNPA2B1 mRNA
16514628
Urethane
  • Urethane results in increased expression of HNRNPA2B1 protein
17477362

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenocarcinoma inferred via Urethane 18316556
Adenocarcinoma, Bronchiolo-Alveolar inferred via Urethane 15814487
Adenoma inferred via Urethane 17093202, 10822126, 17195641, 11497255, 16926031
Cleft Palate inferred via Urethane 12810352
Heart Diseases inferred via Urethane 16046796
Liver Neoplasms inferred via Urethane 17093202, 17559639, 16391232
Lung Neoplasms inferred via Urethane 16204055, 16391232, 16007126, 11307925, 16788158, 16926031, 12957351, 11246140, 17195641, 10822126, 12765245, 14587096, 15136453, 11544531, 11323394, 16289808, 11074608, 11893704, 16337739, 11497255, 12466968, 12117781, 17255336, 11552296, 10997738, 11992545, 15166089, 11062179, 10779650, 11807781, 15902970, 17093202
Neoplasms inferred via Urethane 15625555
Neoplasms, Experimental inferred via Urethane 15582191
Ovarian Neoplasms inferred via Urethane 16391232
Pituitary Neoplasms inferred via Urethane 16391232
Skin Neoplasms inferred via Urethane 11807781
Vascular Neoplasms inferred via Urethane 10620525
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 17952589, 17893378, 15775269, 17440819, 16912660, 16837676, 17595753, 15758505, 15572757, 17049068, 17261762
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 15920148, 17451421
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 15579764, 17823083, 17893378
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11181820, 11445065, 16510128, 15451049, 11124998, 16140633
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Fibrosarcoma inferred via Methylcholanthrene 14633661
Lung Neoplasms inferred via Methylcholanthrene 17909032, 16337739, 16271038, 11893704
Breast Neoplasms inferred via Estradiol 17289903, 12948864, 17261762, 14630087, 18497071, 17018787
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 16891317, 11408345
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Lung Neoplasms inferred via Butylated Hydroxytoluene 11246140, 16337739
Pneumonia inferred via Butylated Hydroxytoluene 11893704
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Pan H, et al. (2008) "Cyclophilin A is required for CXCR4-mediated nuclear export of heterogeneous nuclear ribonucleoprotein A2, activation and nuclear translocation of ERK1/2, and chemotactic cell migration." J Biol Chem. 283(1):623-637. PMID:17991743
  2. [ + ] Sato A, et al. (2008) "Establishment of a new method, transcription-reverse transcription concerted reaction, for detection of plasma hnRNP B1 mRNA, a biomarker of lung cancer." J Cancer Res Clin Oncol. 134(11):1191-1197. PMID:18461365
  3. [ + ] Goina E, et al. (2008) "Binding of DAZAP1 and hnRNPA1/A2 to an exonic splicing silencer in a natural BRCA1 exon 18 mutant." Mol Cell Biol. 28(11):3850-3860. PMID:18391021
  4. [ + ] Miyasaka T, et al. (2008) "Interaction of antiproliferative protein Tob with the CCR4-NOT deadenylase complex." Cancer Sci. 99(4):755-761. PMID:18377426
  5. [ + ] Lindahl Allen M, et al. (2007) "Correlation of DNA methylation with histone modifications across the HNRPA2B1-CBX3 ubiquitously-acting chromatin open element (UCOE)." Epigenetics. 2(4):227-236. PMID:18032920
  6. [ + ] Levesque K, et al. (2006) "Trafficking of HIV-1 RNA is mediated by heterogeneous nuclear ribonucleoprotein A2 expression and impacts on viral assembly." Traffic. 7(9):1177-1193. PMID:17004321
  7. [ + ] Zech VF, et al. (2006) "Prognostic and diagnostic relevance of hnRNP A2/B1, hnRNP B1 and S100 A2 in non-small cell lung cancer." Cancer Detect Prev. 30(5):395-402. PMID:17067748
  8. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  9. [ + ] Strom A, et al. (2006) "Identification of prion protein binding proteins by combined use of far-Western immunoblotting, two dimensional gel electrophoresis and mass spectrometry." Proteomics. 6(1):26-34. PMID:16294306
  10. [ + ] Beausoleil SA, et al. (2006) "A probability-based approach for high-throughput protein phosphorylation analysis and site localization." Nat Biotechnol. 24(10):1285-1292. PMID:16964243
  11. [ + ] Fritsch-Stork R, et al. (2006) "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus." Arthritis Res Ther. 8(4):R118. PMID:16859514
  12. [ + ] Kosturko LD, et al. (2006) "Heterogeneous nuclear ribonucleoprotein (hnRNP) E1 binds to hnRNP A2 and inhibits translation of A2 response element mRNAs." Mol Biol Cell. 17(8):3521-3533. PMID:16775011
  13. [ + ] Fahling M, et al. (2006) "Heterogeneous nuclear ribonucleoprotein-A2/B1 modulate collagen prolyl 4-hydroxylase, alpha (I) mRNA stability." J Biol Chem. 281(14):9279-9286. PMID:16464861
  14. [ + ] Kosturko LD, et al. (2005) "The microtubule-associated protein tumor overexpressed gene binds to the RNA trafficking protein heterogeneous nuclear ribonucleoprotein A2." Mol Biol Cell. 16(4):1938-1947. PMID:15703215
  15. [ + ] Moran-Jones K, et al. (2005) "hnRNP A2, a potential ssDNA/RNA molecular adapter at the telomere." Nucleic Acids Res. 33(2):486-496. PMID:15659580
  16. [ + ] Griffin ME, et al. (2004) "Post-transcriptional regulation of glucose transporter-1 by an AU-rich element in the 3'UTR and by hnRNP A2." Biochem Biophys Res Commun. 318(4):977-982. PMID:15147968
  17. [ + ] Ong SE, et al. (2004) "Identifying and quantifying in vivo methylation sites by heavy methyl SILAC." Nat Methods. 1(2):119-126. PMID:15782174
  18. [ + ] Ishikawa M, et al. (2004) "Immunohistochemical study of hnRNP B1 in the postmortem temporal cortices of patients with Alzheimer's disease." Neurosci Res. 50(4):481-484. PMID:15567486
  19. [ + ] Dellis S, et al. (2004) "Protein interactions among the vaccinia virus late transcription factors." Virology. 329(2):328-336. PMID:15518812
  20. [ + ] Satoh H, et al. (2004) "Expression of hnRNP A2/B1 proteins in small airway epithelial cells." Int J Mol Med. 14(4):605-608. PMID:15375589
  21. [ + ] Beausoleil SA, et al. (2004) "Large-scale characterization of HeLa cell nuclear phosphoproteins." Proc Natl Acad Sci U S A. 101(33):12130-12135. PMID:15302935
  22. [ + ] Ishikawa M, et al. (2004) "Alterations of heterogeneous nuclear RNP A2 and B1 in the hippocampus of the rat after perforant pathway lesion." Acta Neuropathol. 107(2):144-148. PMID:14608468
  23. [ + ] Sun KH, et al. (2003) "Autoantibodies to dsDNA cross-react with the arginine-glycine-rich domain of heterogeneous nuclear ribonucleoprotein A2 (hnRNP A2) and promote methylation of hnRNP A2." Rheumatology (Oxford). 42(1):154-161. PMID:12509629
  24. [ + ] Leonard D, et al. (2003) "hLodestar/HuF2 interacts with CDC5L and is involved in pre-mRNA splicing." Biochem Biophys Res Commun. 308(4):793-801. PMID:12927788
  25. [ + ] Fan X, et al. (2003) "HnRNP A1 and A/B interaction with PABPN1 in oculopharyngeal muscular dystrophy." Can J Neurol Sci. 30(3):244-251. PMID:12945950
  26. [ + ] Li J, et al. (2003) "Regulation of alternative splicing by SRrp86 and its interacting proteins." Mol Cell Biol. 23(21):7437-7447. PMID:14559993
  27. [ + ] Satoh H, et al. (2003) "HnRNP A2/B1 proteins in nontumorous alveolar cells." Lung. 181(4):219-225. PMID:14692562
  28. [ + ] Andersen JS, et al. (2002) "Directed proteomic analysis of the human nucleolus." Curr Biol. 12(1):1-11. PMID:11790298
  29. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  30. [ + ] Brumwell C, et al. (2002) "Intracellular trafficking of hnRNP A2 in oligodendrocytes." Exp Cell Res. 279(2):310-320. PMID:12243756
  31. [ + ] Fritsch R, et al. (2002) "Characterization of autoreactive T cells to the autoantigens heterogeneous nuclear ribonucleoprotein A2 (RA33) and filaggrin in patients with rheumatoid arthritis." J Immunol. 169(2):1068-1076. PMID:12097415
  32. [ + ] Zhou Z, et al. (2002) "Comprehensive proteomic analysis of the human spliceosome." Nature. 419(6903):182-185. PMID:12226669
  33. [ + ] Yan-Sanders Y, et al. (2002) "Increased expression of heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP) in pancreatic tissue from smokers and pancreatic tumor cells." Cancer Lett. 183(2):215-220. PMID:12065097
  34. [ + ] Hutchison S, et al. (2002) "Distinct sets of adjacent heterogeneous nuclear ribonucleoprotein (hnRNP) A1/A2 binding sites control 5' splice site selection in the hnRNP A1 mRNA precursor." J Biol Chem. 277(33):29745-29752. PMID:12060656
  35. [ + ] Jurica MS, et al. (2002) "Purification and characterization of native spliceosomes suitable for three-dimensional structural analysis." RNA. 8(4):426-439. PMID:11991638
  36. [ + ] Pioli PA, et al. (2001) "The von Hippel-Lindau protein interacts with heteronuclear ribonucleoprotein a2 and regulates its expression." J Biol Chem. 276(43):40346-40352. PMID:11517223
  37. [ + ] Kim SH, et al. (2001) "Increased protein levels of heterogeneous nuclear ribonucleoprotein A2/B1 in fetal Down syndrome brains." J Neural Transm Suppl. (61):273-280. PMID:11771750
  38. [ + ] Zhou J, et al. (2001) "Differential expression of the early lung cancer detection marker, heterogeneous nuclear ribonucleoprotein-A2/B1 (hnRNP-A2/B1) in normal breast and neoplastic breast cancer." Breast Cancer Res Treat. 66(3):217-224. PMID:11510693
  39. [ + ] Matsui M, et al. (2000) "Testis- and developmental stage-specific expression of hnRNP A2/B1 splicing isoforms, B0a/b." Biochim Biophys Acta. 1493(1-2):33-40. PMID:10978504
  40. [ + ] Nichols RC, et al. (2000) "The RGG domain in hnRNP A2 affects subcellular localization." Exp Cell Res. 256(2):522-532. PMID:10772824
  41. [ + ] Hamilton BJ, et al. (1999) "hnRNP A2 and hnRNP L bind the 3'UTR of glucose transporter 1 mRNA and exist as a complex in vivo." Biochem Biophys Res Commun. 261(3):646-651. PMID:10441480
  42. [ + ] Pancetti F, et al. (1999) "Heterogeneous nuclear ribonucleoprotein A2 interacts with protein kinase CK2." Biochem Biophys Res Commun. 260(1):17-22. PMID:10381337
  43. [ + ] Neubauer G, et al. (1998) "Mass spectrometry and EST-database searching allows characterization of the multi-protein spliceosome complex." Nat Genet. 20(1):46-50. PMID:9731529
  44. [ + ] Montuenga LM, et al. (1998) "Expression of heterogeneous nuclear ribonucleoprotein A2/B1 changes with critical stages of mammalian lung development." Am J Respir Cell Mol Biol. 19(4):554-562. PMID:9761751
  45. [ + ] Van Laer L, et al. (1997) "Physical mapping of the HOXA1 gene and the hnRPA2B1 gene in a YAC contig from human chromosome 7p14-p15." Hum Genet. 99(6):831-833. PMID:9187682
  46. [ + ] Kozu T, et al. (1995) "Structure and expression of the gene (HNRPA2B1) encoding the human hnRNP protein A2/B1." Genomics. 25(2):365-371. PMID:7789969
  47. [ + ] Faura M, et al. (1995) "Differential distribution of heterogeneous nuclear ribonucleoproteins in rat tissues." Biochem Biophys Res Commun. 217(2):554-560. PMID:7503735
  48. [ + ] Biamonti G, et al. (1994) "Two homologous genes, originated by duplication, encode the human hnRNP proteins A2 and A1." Nucleic Acids Res. 22(11):1996-2002. PMID:8029005
  49. [ + ] Dawson SJ, et al. (1992) "Treatment of Haemophilus aphrophilus endocarditis with ciprofloxacin." J Infect. 24(3):317-320. PMID:1602151
  50. [ + ] Wilk HE, et al. (1991) "U1 SnRNP association with HnRNP involves an initial non-specific splice-site independent interaction of U1 SnRNP protein with HnRNA." Mol Cell Biochem. 106(1):55-66. PMID:1833625