Abcc10 | GeneID:316231 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 316231 Official Symbol Abcc10
Locus N/A Gene Type protein-coding
Synonyms
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Chromosome 9q12
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 58616

ID Symbol Protein Species
GeneID:34140 CG7806 NP_609207.1 Drosophila melanogaster
GeneID:89845 ABCC10 NP_258261.2 Homo sapiens
GeneID:224814 Abcc10 NP_733780.1 Mus musculus
GeneID:316231 Abcc10 XP_236930.4 Rattus norvegicus
GeneID:421456 ABCC10 XP_419506.2 Gallus gallus
GeneID:462717 ABCC10 XP_518494.2 Pan troglodytes
GeneID:481813 ABCC10 XP_538934.2 Canis lupus familiaris
GeneID:508399 ABCC10 XP_585169.3 Bos taurus
GeneID:815414 ATMRP11 NP_178811.3 Arabidopsis thaliana
GeneID:1278042 AgaP_AGAP007917 XP_317569.2 Anopheles gambiae
GeneID:4340331 Os06g0184700 NP_001056996.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001108201  UCSC Browser NP_001101671
2 XM_001066454  UCSC Browser XP_001066454
3 XM_236930  UCSC Browser XP_236930

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000025598 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSRNOT00000025598 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENSRNOT00000025598 MI0003649 hsa-miR-634 AACCAGCACCCCAACUUUGGAC
ENSRNOT00000025598 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSRNOT00000025598 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000025598 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSRNOT00000025598 MI0000245 mmu-miR-202-3p AGAGGUAUAGCGCAUGGGAAGA
ENSRNOT00000025598 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSRNOT00000025598 MI0005519 mmu-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSRNOT00000025598 MI0004123 mmu-miR-675-3p CUGUAUGCCCUAACCGCUCAGU
ENSRNOT00000025598 MI0004123 mmu-miR-675-5p UGGUGCGGAAAGGGCCCACAGU
ENSRNOT00000025598 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENSRNOT00000025598 MI0004689 mmu-miR-705 GGUGGGAGGUGGGGUGGGCA
ENSRNOT00000025598 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSRNOT00000025598 MI0005480 mmu-miR-876-3p UAGUGGUUUACAAAGUAAUUCA
ENSRNOT00000025598 MI0000601 rno-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENSRNOT00000025598 MI0000832 rno-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENSRNOT00000025598 MI0000891 rno-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENSRNOT00000025598 MI0000896 rno-miR-125b-3p ACGGGUUAGGCUCUUGGGAGCU
ENSRNOT00000025598 MI0000936 rno-miR-193 AACUGGCCUACAAAGUCCCAGU
ENSRNOT00000025598 MI0000946 rno-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENSRNOT00000025598 MI0000948 rno-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENSRNOT00000025598 MI0000951 rno-miR-211 UUCCCUUUGUCAUCCUUUGCCU
ENSRNOT00000025598 MI0000631 rno-miR-345-5p UGCUGACCCCUAGUCCAGUGC
ENSRNOT00000025598 MI0003549 rno-miR-485 AGAGGCUGGCCGUGAUGAAUUC
ENSRNOT00000025598 MI0006169 rno-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSRNOT00000025598 MI0006163 rno-miR-758 UUUGUGACCUGGUCCACUAACC
ENSRNOT00000025598 MI0000641 rno-miR-7a UGGAAGACUAGUGAUUUUGUUGU
ENSRNOT00000025598 MI0000836 rno-miR-7a UGGAAGACUAGUGAUUUUGUUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene