Abcb5 | GeneID:314537 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 314537 Official Symbol Abcb5
Locus N/A Gene Type protein-coding
Synonyms RGD1566342
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 5
Description ATP-binding cassette, sub-family B (MDR/TAP), member 5
Chromosome 6q33
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 83488

ID Symbol Protein Species
GeneID:77706 Abcb5 XP_001002680.2 Mus musculus
GeneID:314537 Abcb5 XP_234725.4 Rattus norvegicus
GeneID:340273 ABCB5 NP_848654.3 Homo sapiens
GeneID:482344 ABCB5 XP_539461.2 Canis lupus familiaris
GeneID:743269 ABCB5 XP_001152831.1 Pan troglodytes
GeneID:839687 PGP13 NP_174115.1 Arabidopsis thaliana
GeneID:839694 PGP14 NP_174122.1 Arabidopsis thaliana

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001062082  UCSC Browser XP_001062082
2 XM_234725  UCSC Browser XP_234725

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000056660 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSRNOT00000056660 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSRNOT00000056660 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSRNOT00000056660 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSRNOT00000056660 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENSRNOT00000056660 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENSRNOT00000056660 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSRNOT00000056660 MI0005481 mmu-miR-105 CCAAGUGCUCAGAUGCUUGUGGU
ENSRNOT00000056660 MI0005487 mmu-miR-220 CCACCACAGUGUCAGACACUU
ENSRNOT00000056660 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSRNOT00000056660 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSRNOT00000056660 MI0005516 mmu-miR-509-3p UGAUUGACAUUUCUGUAAUGG
ENSRNOT00000056660 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSRNOT00000056660 MI0000947 rno-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSRNOT00000056660 MI0003554 rno-miR-20b-3p ACUGCAGUGUGAGCACUUCUGG
ENSRNOT00000056660 MI0000961 rno-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENSRNOT00000056660 MI0000861 rno-miR-28* CACUAGAUUGUGAGCUCCUGGA
ENSRNOT00000056660 MI0000966 rno-miR-292-3p AAGUGCCGCCAGGUUUUGAGUGU
ENSRNOT00000056660 MI0000966 rno-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSRNOT00000056660 MI0000870 rno-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENSRNOT00000056660 MI0000867 rno-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSRNOT00000056660 MI0006112 rno-miR-466b UAUGUGUGUGUGUAUGUCCAUG
ENSRNOT00000056660 MI0006113 rno-miR-466b UAUGUGUGUGUGUAUGUCCAUG
ENSRNOT00000056660 MI0006169 rno-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSRNOT00000056660 MI0006160 rno-miR-708* CAACUAGACUGUGAGCUUCUAG
ENSRNOT00000056660 MI0006126 rno-miR-883 UAACUGCAACAUCUCUCAGUAU
ENSRNOT00000056660 MI0000838 rno-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSRNOT00000056660 MI0000839 rno-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENSRNOT00000056660 MI0000840 rno-miR-9* AUAAAGCUAGAUAACCGAAAGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]