Aadacl3 | GeneID:313686 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 313686 Official Symbol Aadacl3
Locus N/A Gene Type protein-coding
Synonyms RGD1563257
Full Name arylacetamide deacetylase-like 3
Description arylacetamide deacetylase-like 3
Chromosome 5q36
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 28426

ID Symbol Protein Species
GeneID:126767 AADACL3 NP_001096640.1 Homo sapiens
GeneID:230883 Aadacl3 XP_144109.1 Mus musculus
GeneID:313686 Aadacl3 XP_233636.4 Rattus norvegicus
GeneID:457970 AADACL3 XP_514407.2 Pan troglodytes
GeneID:487435 AADACL3 XP_544560.2 Canis lupus familiaris
GeneID:530613 AADACL3 XP_609088.2 Bos taurus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001074227  UCSC Browser XP_001074227
2 XM_233636  UCSC Browser XP_233636

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000033150 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENSRNOT00000033150 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSRNOT00000033150 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSRNOT00000033150 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSRNOT00000033150 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSRNOT00000033150 MI0005485 mmu-miR-197 UUCACCACCUUCUCCACCCAGC
ENSRNOT00000033150 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENSRNOT00000033150 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENSRNOT00000033150 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSRNOT00000033150 MI0000832 rno-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENSRNOT00000033150 MI0000876 rno-miR-34c* AAUCACUAACCACACAGCCAGG
ENSRNOT00000033150 MI0003551 rno-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSRNOT00000033150 MI0003551 rno-miR-369-5p AGAUCGACCGUGUUAUAUUCGC
ENSRNOT00000033150 MI0003544 rno-miR-376b-3p AUCAUAGAGGAACAUCCACUU
ENSRNOT00000033150 MI0003719 rno-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSRNOT00000033150 MI0003547 rno-miR-487b AAUCGUACAGGGUCAUCCACU
ENSRNOT00000033150 MI0006154 rno-miR-532-3p CCUCCCACACCCAAGGCUUGCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]